Basic Information

Symbol
MYH7
RNA class
mRNA
Alias
Myosin Heavy Chain 7 CMD1S Myosin, Heavy Polypeptide 7, Cardiac Muscle, Beta MyHC-Beta Myosin-7 MYHCB CMH1 MPD1 Myosin Heavy Chain, Cardiac Muscle Beta Isoform Myosin, Heavy Chain 7, Cardiac Muscle, Beta Cardiac Muscle Myosin Heavy Chain 7 Beta Rhabdomyosarcoma Antigen MU-RMS-40.7A Myosin Heavy Chain Beta-Subunit Myosin Heavy Chain Slow Isoform Myopathy, Distal 1 Myhc-Slow MyHC-Slow Myosin 7 CMYO7A CMYO7B CMYP7A CMYP7B SPMD SPMM
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_000257.4
Sequence length
6027.0 nt
GC content
0.5731

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2289.90 kcal/mol
Thermodynamic ensemble
Free energy: -2389.40 kcal/mol
Frequency: 0.0000
Diversity: 1252.84
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...(((((((((.((((((.(((((((..((((((.....(((((((((((((.((((((((((((.((((.((((........((((((..(((((((...))).))))..))))))....((((((((...))))))))(((((((.(((((....).))).).))).).)))(((..(((.((((....((((((.......))))))..)))).)))..))).((((((((....))))))))..((((...(((.((((((.(..((((((...)))))).))))))))))...))))...)))))))..).))))).)).))))).....(((((....(((......(((((.....)))))....)))...))))).....)))))).(((((.(((((.((...........)).)))))...)))))(((((((((((.((((..((((((........(((((((((.((.((((....)).)).)).))))).)))).))))))..))))..(((((....)))))((((((((.(((......))).))...))))))...((((((....)).((.(((((....))))).))...))))......(((..(((((....(((((...)))))..)))))..)))..............)))))))))))......(((((....)))))....))))))))))))).)))))))))))))..)))).)))))..((((((.((.....)).))))))......((((((((((.(..((((((...))))))..).))))))........(((((((((((((((((((((....)))))..))))))))).........((((((((((.(((..((((....)))).(((((((....)))))))..........(((((..(((((..(((((..........(((((((..((((((.........((((((((((.((.((..(((((((..((..(..((..((((.(((((.(((..((.(((((...))))))).....((((((.......((((.(((....)))))))))))))......((((((.....((((.((((((.((((((.((((.....))))........((..((((.(.((.(((((...........)))))..(((..((((...))))..)))((((((((((.(((....))).)))...((((.((....)).)))).((....))(((((....)))))..)))))))..)).)))))))((((....))))...((((.((.(((((.((((((((..(((((...)))))..(((.(((.((((.((.((.(.((((((.(...).)))))).).)).))))))))).)))..)))))))).)).))).)))))).))))))......((((((..(((((.((((...))))(((((.((.((((..(((((((((((...))))))..(((((((..(((((((((((....((((........)))).)))))(((((((((..(((.((....((((((((...........))))))))..((..((((((.(((((....)))))..(((((((((...((((((..(((((((((.((((.(((.(..(((..((((...(((((.(.((((.....))))).)))))...)))).)))..))))......((((..((((...(((((((....(((((..((((....(((...(((((((.((((........(((.(((((((..((.....))))))))).)))(((((.(((....))).))))).............((((((((((.((......(.(((..((((...))))..))).)((((((((.(((((((((((......(((((((((((...(((((((.((......(((((.(((((((((((.(((.......)))))))..((((......)))).(((((((((((....(((((((.((..((((.....))))..)))))))))..(((.(((((((((((((((((((((((((....((((((((((((((...(((((...))))).)))))))))..))))).((.(((((.....(((((.(((((.....))))))))))((.((.((((((((((((((...(((((((((.........(((((((.....(((((((((.....(((..((((....(((((((((.((((...))))..(.(((.((....((((.((.((((((.....))))))..)).))))..)).))).)....(((((...(((((((((((((....)))).......)))))))))))))))))))))))))))..)))(((((..(.((((((..(((........)))..))..))))).)))))....(((((((.........))))))).....)))))))))))))))).....(((((((....))))))).......)))(((((((((((((((.....((((..(((.(((((.....)))))...))).))))((((........))))...............))))))))))))))).(((.(((.(.((((((...))))))...).))).)))))))))(((((((.(((((((.(((.....((....((((((...)))).))...))..))).)))))))...))).))))...........))).))))))))...))))).)).....(((((((((........)).)))))))..))))).))................)))).))).))))).))............(((((((((((.(((....((....))))).)).)))..))))))(((((...(((..((....)).))).)))))(((..(((((...(((............))).............((((.....))))..(((((....(((.((((((........((.((((..((((...............))))..))))))))))))))).....)))))..((.(((((.......))))).)).(((((......)))))..)))))..)))....)))))).))))))))....))))))))))).(((((............((((.(....).))))...((.......))(..((((..(((....)))..))))..))))))...)))))).)..)))))....)).)))))))..))....)))))))))........))))))))((((.....))))(((((.....).))))...))))))))))))).))))))))))......(((((((...))))))).((((((((((((((..(((((((..(((((...((((..(((((((..(((((((..(.((.....((((((........(((((((.(..(.(((((....((((((((((((......)))))(((((((...)))).)))...................((((..((((..((((((.....(((((((((.(((.....))))).)))))))......((((((.((.(((((..(((.......))).)))).).))))))))..((((((.((((...((..(...((.((((...((...))...)))).))..)..))....(.(((((......))))).)...(((((..(((((...)))))...(((((((((((....))...(((.((.....((((((((..(((((....((((.(((..((((((.((.((.(((.((.(....))).((((((((((...((((((..(..(((((..(((.((((((...........(((((((((((.((((((((((..((..((......))..))..)))))))..))).))).))))))))........)))))).(((...)))....))).)))))..)..))))))..)))..)))))))))).))))..((.((((((((((((.(((.((.((.(..((((((((....)))))).).)..).)).))...)))..)))))).)))))).))(((((((.(..(((((.((....)))))))..).)))))))..........((((.(.((..(((((...(((...(((.((..(.(((((.(......)))))))..))))).)))...))))))).).))))...(((.......)))..)))))).)))))))......)))))..))))).)))........)).))).))))))))).))))).((((.((((..(((((((.((((..((((.(.......((..((((.(((....))).)))).))).)).))..)))).)))).(((((.((.((((....)))))).))))))))...)))))))))))).)))))).....((((((((................)))))))).(((.(..(.(((((((((((((..(((((..........)))))..)))).).)))))....(((((((((..((((.(((((((.....((((.((((.....))))...))))........))))))).)))).........))).))))))((((.((((((...(..(.(((((.((.....)).))))).)..).))))))))))((((((...((((.....((((........))))))))...))))))...))).)..).)))...)))))).))))..)))).((((((....))))))...)))))))....)))))..)..).).))))))))))))..)).)..)))))))..))))........((.((.......))))..((((.(((....))).))))((((.((.....)).)))))))...))))....)))...)).....)))))))..)))(((....)))..((((......)))).)))))).....)))))........(((((.((.((...)).)).))).)).((((((........)))))).))))...)))))))....)))))))..)))))..)))))))...)).))..))))((((.(((((((.(((((.....(.((....))).....))))).)))).))))))).....((((.(((((..............)))))..))))..(((...)))(((((........))))))))))))))))))..)))))).))))))))).((.((((.....)))).))...)))))).)).)).)))..)))))))))........(((((...((.((((((....)).))))............((((......))))...)).))))).((..(((((......))))).))....(((((....)))))((.....)))))))).)))))))))))))))))).))))))))))....)).)))))))))).))))))))))....))).)))))....))))..))..)..))...)))))))..)).)).))))))(((.((....))))).((.((((.....))))))..))))))))))..))))))).(((((((..((.....(((((.(((....(.((((((((..(((((((..((......)).........((((((..(((((((...((.((((....)))).))...))...)))))))))))....))))...)))..))))........((((........)))).....)))).)..))).)))))...))..)))))))......)))))..)))))))))).))).))))))))))..(((.....)))(((((.(((...))))))))..))))))).))))..........................
Thermodynamic Ensemble Prediction
...((({(((((.((((((.(((((((..((((((.....((((((((((((({((((((((((((,{(((.((((.......,{{((((..(((((((...))).))))..))))||.|.,((((((((...))))))))|{|{{{{.{((((,,..},|}}.}.}}}.}.)))|{{..|||,||{{,{,,(({{{{{,,.,|.}}}}}),.)))}.})},,))).((((((((....))))))))..((((...(((.((((((.(..((((((...)))))).))))))))))...))))...)))))))..}.))))).)).))))).,...(((((....(((.,,...{((((.....))))),...)))...))))).....)))))).(((((.(((((.((...........)).)))))...)))))(((((((((((.,.((...,.||{((((....(((((((((.((.((((....)).)).)).))))).))))....))))|({(({.(({{{..,{|||}}((((((((.(((......))),))...))))))...,|||}|.....,.((.(((((....))))).)).,.,.,.......(((..(((((....(((((...)))))..)))))..))).}},..,,}}..,.)))))))))))......(((((....)))))....))))))))))))).)))))))))))))..))))){|||,..((((((.({.....)).))))))....}}}|{,(((((({(.,((((((...)))))).}).))))))........(((((((({{{(((({{((((....)))))..,}}||||||.........((((((((((.(((..,{((,...}}}),{((((((....))))))}..........(((({.,(((((..(((((..........(((((((..((((((.........((((((((((.((.((..(((((((,.((.,(..((..((((.(((({.(((..{(.(((((...))))))}.....((((((.......((((.(((....))))))))))))).,....((((((.....((((.((((((.((((((.((((.....))))........(((....|||,({,{{{{{,,{{{{{....,,}))}}|{{..((((..,||||..|||({{{((((((,{({...,|||.||}...||||||,....)),)))).||,,..}}(((((....)))))..}||||||..,|{||||{..((((....))))...({{((((.(((((.((((((((..(((({...}))))..(((.(((.((((.((.((.{.((((((.(...},)))))).}.)).))))))))}.)))..)))))))).)).))).))))}).}|||||.,|,.|||{{|,,,((((.(((((...))))).)))).,.,|)|)}|}}||((((((...))))))..||||{{|.,|({{(((((({,(..((((........)}}}{|||,|{|{((((((..(((.({({..,,||||,|}}.....,.,,)}},},,,..,{..((((((.,((({....,},}|..(((((((((...((((((..(((((((((.((((.(((.{..(((..((((...(((((.,.((((.....)))),.)))))...)))).)))..}))}......((((..((((...(((((((....(((((..((((....(({{({((((({(.{(((..,{,..,(((.(((((((..,{.....},))))))).)))|((((.(((..,,)}).}))),........,...,{(((((((((.{.........,,{.,(({{...))),,,|||{.((((((((.(({((((((((...{{.(((((((((,(...(((((((.((......(((((.(((((((((((.{{{....,,,)}}}}}}..((((......)))).(((((((((((..,{(((((((.((..((((.....))))..)))))))))..((,{((((((((((.((((((((((((((,{.{((({((((((((((...(((((...))))).))))))))),.}}}}}{{({(((((.....(((((.(((((.....))))))))))((.((.((((((((((((((...(((((({{{.........(((((((.....(((((((((,,,..,,...{|||....(((((((((.((((...))))..,.,,,.((,,..{{{,.(({((((,({{...,,,))).}))}))),..},.}}),},...(((((...(((((((((((((....)))).......)))))))))))))))))))))))})}}..,,.(((((..(.((((((..(((........)))..))..))))).)))))....(((((((.........))))))).....))))))))))))))))..,,{{{(((((....))))))).......))}(((((((((((((((.....{(((..{((.(((((.....)))))...))}.)))}((((........))))...............))))))))))))))).(((.(((.{.((((((...))))))...}.))).))))))))}(((((((.(((((((.(((.....,{....((((((...)))).))...,}..))).)))))))...))).))))...........))),})))))))...))))).))....,(((((((((........)),})))))),.))))}.)).,..,,....,.))},}))).))).))))).))....,.,,....(((((((((((.((,...{((....))))).}).))),.)))))).,{||....|||.|,,,..,,.})}..{((((((..(((((..((({{....{,.......,.............((((.....))))..(((((....(((.((((((........{{.((((..((((...............))))..))))}}))))))))).,...))))),.(((((((....((.....)).,))))))).,..}}}.)))..)))))..))),,)))))))).)))))))).,,.))))))))))),(((((.{{,........((((.(.,..}.,|||...({..{{...}}{..,{||..|||}}..)))..,)))..})))))...)))))).}..))))),...)).)))))))..),}}..}))))))))},......)))))))){(((.....)))|(((({.....}.)))),,.))})))))))),)}))))})}})}}|.,..(((((((...))))))).((((((({(((,.{{{((({{({,{(,{(({{,((((,.(({((((..(((((((..{,((.....((((((........(((((({,(.,({(((((,,.,((((((({,((({{{...||||,,,..|}}}...)))},))...{|,....,........((((..((((..((((((...,.(((((((((.(((.....))))).))))))).,....((((((.((.(((((..(((.......))).)))).).))))))))..((((((.((((...{{..{...((.((((...{{...}}...)))).))..}..},.,.,(.{((((..,,,,||||}.}...(((((..(((({...}))))...(((((((((((....))...(((.((.....((((((((..(((((....((((.(((..((((((.,(.(({.(({({.({...,}}.((((((((((...((((((..(..(((((..(((.((((((...........(((((((((((,((((((((((..((..((......))..))..)))))))..))).))),})))))))........)))))),(,{..,)}}....))).)))))..)..))))))..}}},.}))))))},}})))}.{((.((((((((((((.(((.{{.((.(..((((((((....)))))}.,.),.).)).)}...)))..)))))).)))))).))|{(({{({({.(((({.((...,)})))))...})))))}},.........{{{{.|,{{.{(((((...(((...(((.((..(.(((({,{......)))))))..))))).)))...))))))}.}}))))...|||}.,...,)))..)))))).)))))))......)))))..))))).)))...,....)).))).))))))))).))))).{{((.((((..(((((((.((((..((((,(.......({..((((.(({....})).)))).))).)).))..)))).}))}.(((((.((.((((....)))))).))))))}}...)))))))))))),)))))).....{(((((({..,,{......,.,,.))))}}}|{(((.(..{.{((((((((((((..(((((..........)))))..)))).}.)))))....(((((({((..((((.(((((((,,...((((.((((.....))))...))))......}.))))))).)))).........))).))))))((((.((((((...,..{,((({(,({,....)}.))})).)..,.))))))))))((((((...((((.....((((........))))))))...))))))...}}}.)..).))).,.)))))).))))..)))).((((((....))))))...))))))).,..})))),.)}.).).)))))))))))),.),.)..)))))))..))))...........,,..{{...}})}..{(((.(((....))).)))}((((.((.....)).))))}}}.,,)))),....,,...))..,.,)))))}}.,))}{|||,.,|,|..||{{.|||||||||,|}}}}}.}}}}}|}}}..|,|{{,,{{({.{{.,....)),}).)))}}).((((((........)))))).)))),,,))))}}},}}))))))))..)))))..)))))))...))})}.,)))}((((.({{(((({{((({({{{.,.{|,||.}}}{{{{{|||,,.))))}},))),}.....((((.{((((..,...........)))))..)))).}})))}})))||({{........))))))))))))))))))..)))))).))))))))).{|.((((.....)))).})}}.))))))|||}}},)))).}}}}}})))........{((({...{(,((((((....)).)))).,,.........((((......))))...},.})))},{|..(((((......))))).}}.,.,(((((....)))))|{.....}}|)))}),}.}}))}},,))))})))}))))}))))}....,)})))))))))).))))))))))....))).}))))....})))..)).,)..)).,.)))))))..)).)).))))))(((.((....))))).||,((((.....))))|}..))))))))))..))))))),(((((((..((.....(((((.(((....(.((({((((..(((,,(((.((.,...(({..{.{{..{((((((..((((,((...,,.,,||..}}))))})).,}),...)).),.))),,.,.)),))}..)))..)))).....,.|{(((,,.....,)))),....)))).)..))).)))))...))..))))))),}....)))))..)))))))))).))).))))))))))..,||},,,.}},(((({,(((...))))))))..))))))},||,}......}}...,,,.,,.,.,)}...

Transcripts

ID Sequence Length GC content
ACAGCUCUGUCCUGCUCUGUGUCUUUCCCUGCUGCUCUCAGGUCCCCUG… 6027 nt 0.5731
ACAGCUCUGUCCUGCUCUGUGUCUUUCCCUGCUGCUCUCAGGCACAGCC… 5971 nt 0.5729
Summary

Muscle myosin is a hexameric protein containing 2 heavy chain subunits, 2 alkali light chain subunits, and 2 regulatory light chain subunits. This gene encodes the beta (or slow) heavy chain subunit of cardiac myosin. It is expressed predominantly in normal human ventricle. It is also expressed in skeletal muscle tissues rich in slow-twitch type I muscle fibers. Changes in the relative abundance of this protein and the alpha (or fast) heavy subunit of cardiac myosin correlate with the contractile velocity of cardiac muscle. Its expression is also altered during thyroid hormone depletion and hemodynamic overloading. Mutations in this gene are associated with familial hypertrophic cardiomyopathy, myosin storage myopathy, dilated cardiomyopathy, and Laing distal myopathy. [provided by RefSeq, May 2022]

Forensic Context

A study in pigs demonstrated that the MYH7 gene, a marker for slow muscle fiber type, was measured but no significant change in its expression was reported in skeletal muscle after short-term cold exposure [Yang et al. DOI:10.3390/ijms24087431]. In human forensic medicine, the MYH7 gene is a genetic biomarker linked to hypertrophic and dilated cardiomyopathies and is frequently implicated in sudden cardiac death investigations, where molecular autopsy through next-generation sequencing can identify pathogenic variants for cause-of-death clarification [Sacco et al. DOI:10.3390/ijms27020670].