Basic Information

Symbol
MYH7B
RNA class
mRNA
Alias
Myosin Heavy Chain 7B KIAA1512 LncMYH7b MYH14 MHC14 Myosin, Heavy Polypeptide 7B, Cardiac Muscle, Beta Antigen MLAA-21 Slow A MYH14 DJ756N5.1 Myosin-7B Myosin Heavy Chain 7B, Cardiac Muscle Beta Isoform Myosin, Heavy Chain 7B, Cardiac Muscle, Beta Myosin Cardiac Muscle Beta Chain U937-Associated Antigen
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_020884.7
Sequence length
6551.0 nt
GC content
0.6158

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2774.50 kcal/mol
Thermodynamic ensemble
Free energy: -2880.14 kcal/mol
Frequency: 0.0000
Diversity: 1709.32
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....((((.((......))))))((((((((((((((((..((((....)))).(((((...)))))))))))))).)))).((.(.(((((((.((...(((((((.(((((((....((.((......)).))...)))))))))))))).((((((((((((.....)).)))))...)))))....((((.((((((......)))))).)))).(((((....)))))(((((((((.............)).))))))).......((((((((((((((.((...(((((((((((........((((((((((..((.((((..((((((......))).)))(((.((((.......(((.(((...))))))))))))).((((.(((((...((((((((((..((.(((((((....(((((((.(((((((((((((((((.((((((((((...((((..(((.....)))..)))).((((((((.....((((((......((((((((((.........(((((((((((.......((((.......)))).(((((..(((((((.((((((((.((((((.(((((.((((((((((((((((((((((((.....((((..(..((.((((.(((..........)))...)))))).((((.((.((.(((...))).)))))))))..)))).....)))))))))....((((((..((((((((((..((((..(((.(((((((..(((.((((.....))))((((((.......))))))............)))..)))))))))).))))...)))))...........))))).((((((.((..(.((((((.((((((.((((........)))))))))))....((((((((.(((....))).))))).)))...(((.(((..(..(.((((......((((((((.((((.((((.((((.(.((((....)))).(((((......))))).......(((.(((((((((((((((((((((((((.(((((..(((.....(((...((..(((((((....((((((((........(((..(...((((((.(((...))).)))))).)..)))))))).)))))))))).))...)))....))).............(((((((((((((((((((.((((((((....((((......(((((((((((((..(((....))).....)))))...)))))))))))).)))))))).)))..((((((((....)).)))))).....((((......))))(((((...)))))..))))))))..........(((((((((((...(((...............(((((((..(((((((.(((((((.((((.....))))..)))))((((((..(((((..((((.(.....(((..((....))..))).....))))))))))....((((((((.........)))))))))))))))).)))))))..)).)))))))).)))))))))))))))))))..))))).)).))))))))....)))))))))....(((((((.((....))))).))))..(((((....)))))..((((((..(((((....))))).....((..(((....)))..))...(((((((((.(..((((((.....))))))....).)))))))))))))))....)))))).)))).)))))))))))))))))))).....(((((((((((......((((((....)))))).....)))))).))))).....((((...(((((.((...)).)))))))))...(((.(((((((((.....((((....))))....)))).))))).)))..((((((((....)))))))))))))..)..)))...)))))))).))).))))))))))))...))))))))))).....((((....))))((((.....))))....))))))))).)))))).)))).....((.(((((....))))))).)))))))))))....))))).((((((.(.(((........((..(((((..(((......((((((((.(((((((((((.................))))))......)))))(((((((...((((((.....))))....))...))))))).))))))))........))).)))))..))))).).)))))).))))))).....)))).......))).))))))).(((.....)))......))))))....((((....)))).)))))))))))))))))).)))..((........)).((((((((...))))))))..(((((.....(((....))).....)))))....(((.(((((((((((..(((((((((((((((((((......(((((...............(((..((((((.(((((((((((((.(((...((.(.((((((....((((((((((..((((((((((........))..))).)))))..))))..)))))).........(((((((((.((((...((((.(.((((((((((((..(((....(((((((.....((((((................))))))((((.((((((((.((......)).))).)))))..))))...(((.((((((((((....((((((((((((...(((((((((((((((((((((((..(.(((((((((((((((.((.(((((.(((.....)))))))).)).))).))))))))....(((((....)))))((((((.((((((((((.........)))))...))))).)))))).......)))).)..)))))))))))....)))))))((((...))))(((((((((.(.((((((....))))))..).))).))))))(((((((......)))))))....(((...(((..((((....))))..)))...)))))))).))))))).((.((......)).)).)))))..))))))).))))))((((.(((((((((((((((((((......((((((.(((......))))))))))))))...)).)))).....)))))))).)))))))))))......))).))).)).))))).)).).))))...))))..))))).)).)).((.((.(((((....))))).)).))))))))))))))))))))))).)))).)))))))))(((((.....((((...(((((...(....(((.(((((((.......((((.....))))........)).)))))..)))...)...))))))))))))))...............(((.(((((((..(((((((....))...)))))..))))))))))..)).)))((((((..(((((((........((..(((((((..((((((.(((((.....)))))...))))))))))))).))......))).))))....)))))))))))))...(((..((((..(((....)))..))))..))).))))).)).))))).(((((((.......)))))))(((((......(((((..((........)).)))))...))))))).))))))))))))........((((((((....((((((.(((((...............)))))..)).))))..))))))))...)))))))))))))).(..((..((((((((.(((((((.(....(((...))).....).)))))))..))))....))))..))..)..)))))))....))))))).)).(((((.((((((......)))))).)..))))..(.((.((((.....)))).)).)....((((.((..(.((.(((((.(((.....))).))))).)).).)).)))))).))))))))...))))).))))...))))))..))))))))))(((((...))))).((((....))))...((((((((((((..((((((..((...(((..((.((.(((((((....((.((.((((..(((.......((((..(((.....(((((..((..........))..)))))..))).))))........)).)..)))))).))..)))))))))))..)))...))))))))((((((((((.(((.(............)))))))))))))).....((((((((.(((((..((.(((((((..(((.......))).((((((((.....((((((.((((((.(((((((.(((..........)))..))).........((((.((..((((((((((.(((((((.(.(..((.((.((((((((((..(((............(((....)))..(((....((((..((((((((.((((.(((((.........)))))...))))..))).))).))..))))..))).(((((............)))))....((((.........))))..)))..)))))))))))).))..)).))))))).))))...(.(((.((((((...((((.((...(((..(((.(((((.(((.....(((....)))......))).))))).))).)))...)))))).((((((((.((.....))..)))))))).........))))))))).)..))))))..))))))....(((..(((((((((.(((..((((.((.....(((...))))).)))).))).))(..(((((((((((.(((...((((.((((......))))...((((.((....(((..(((((..........)))))..)))....)).((..((((.(((..(((.((.((((((.(.......((.(((((...((((......))....))...)))))..))......).)))))).))..)))..)))))))..))..))))))))))).)))))))))))..)....)))))))..))).)))).)))))).))))))..........)))).)))).))))))).))...))))).((..((((((.......)))))).))...(((..(((((((.(((.(((((..((.....)).))))).)))..(((((((....(((((((((((((((.((.........((((....))))......)).))))))))))(((((..((((...(((((((((.....))))...(((((...))))))))))..))))..))))).(((((((((((..(((((((..((((.((..(((.((((..(((((((((.(.(((((.((.((((.((((....))))))))))))))).)((((((..((...))..))))))(((((((((...)))))).)))((.(((((...)))))...)).)))))))..))..))))))).)).))))..))((((((....))))))....((((((((..(((.........((((((.(.((....)).))))))).........)))..))))))))(((...(((((((((((((((........)))).....((((.(((((..((((((((...))))))....(((........))).(.((....)).).((((((...((..(.....)..))(((((((...((.....)).))))))).((((((..((((.(((.......)))..))))...))))))......))))))))..)).))).))))......((((.((.((.((((.((((.(((((((((((((.............(((((...(((((((((....)))))..(((((((((.....((((((.(((((((((...(((..((((.....)))).))).......)).))))))).....(((((...((....(((((.((.......))...)))))....))...))))).(((((.........)))))......((((..(.(((((....))))).)..)))).....)))))).)))))))))......((((((..((..((....((..((.((((((....)))))).))...))....))..))..))))))...))))))))).............)))))).)))))..)).))))..)))).)).)))))).))))))).)))))))..))))))))))).))))).)))))...)))))))..........)))))))..))))))))))))))))))))))).)))))))))))..)).)).))).))).))).)))...)))))))))).))...........(((((....))))).......))).
Thermodynamic Ensemble Prediction
.,{{((((({((..{{{{|||{{{{{.{((((((((((((..((((,,.,))}}.(((({...}))))}}})))))).)))),{|...|||,|||||{,..(((((((.(((((((....((.((......)).))...)))))))))))))).,{{{{{||{|||...,.|}.}}))),,,}|}||.,{,((((.((((((,....,)))))).)))}.|{(((,,,,}||||{(((((({{.,...,,,...,.},.)))))))},,|((.((((((.(,(((,((,,...((((((((((...(((.((((((,(((((((((((,,,..(({(((......))).)}},,({(((........((({,((,..|||||||||}||||{{({(((,,((((((((((((.((((.,((((((({{(((((...}))))}{((,(((((((((((,,.(((((((..((((..(((.....)))..)))).))}})))).{.(((((((((.((((((((((((((.((((({{.(((({{.{(.((((.((.(((((((((.((((.......(((((((((((((((.....)))).))))....{((((((((,{({,((((({((({{...{(((..(,.,(,({{{.({(...|,....,}|,...)))}}}.{(((.((.{{.{((...))).)})))))))..)))),,,,,)))}))))){{{((,({.{.,(({{((({(({{(((,..(((.(((((((..(((.,(((.....)))}((((((.......))))))............)))..))))))))))})))))}.)))},..........}))}))}}}})),....))))))))}.((((((.((((.,....,.))))))))))))))))))))).)))))....,{(,{{{((((.....)))).}}..)}.|||((((((...(((((((,,((((.((((.((((.(.((((....})}),(((((......))))}.....,.{((.((((({(((((((((((((((((((.((((({(((({{,.{((((..,,.....|))))..}||||(((,.......,((({{{...((((((.(({...})).)))))),}..)))))}},.}},|)))|||{||...)))}}}.||}...}}........(((((((((((((((((((.((((((((....{({{.,,,..(((((((((((((.((((....}},..|,.)))))...))))))))}})).)))))))).))}..{{{{{{(({,,.||.|||))}.....||{{..,.,,)),{(((({...)))))}.))))))))..........(((((((((({,,.((({,......,......{{(((((..(((((((.(((((((.((((.....))))..)))))((((((..(((((,.{(({{{.....(((..((....))..)))....,})))))))))....((((((((.........)))))))))))))))).)))))))..)).)))))))),)))))))))))))))))))}}))))).)),})))))))....)))))))))....((((({{.((,...}}})),}})),,{((((....)))),..((((({.{(((((....)))))}....((..(((....)))..))...(((((((((.(..((((({.....}))))).}..).)))))))))})))))....)))))).)))).)))))))))))))))))))).....((((...))))......(((((((.,.(((((((((((((..((((.(((.(.(((((.((((...((((((({,((((.(((((((({{{.{((((((((.....((({....})))....)))},))))),|}}..((((((((....)))))))).,,,,|||||{,.{..,({{{{{{{{.||,.,,)}}))))).,|,.(((((((((((.{(,((((((((.(.....((((.((.((..(((.((.(((.((((|((,..{{{||.(({({(,,...,,)))))).,}}..,,.}}}.((((((((((.(((...(((({((....(((((((((.......(((..,(((((((..((((.((((((.....,((.,..||.((,{((((((...{..((((..(((((((....)))))))..})))..}...))))))|||{,(,{{{.......(((((((((........(((.((.((((((...((((.((((........)))).)))).,.,(({{...))),....,{,((((((..{,.,....))))}|((((....))))}.....,.,.{(({((((((((((((((((((...))))))))..(((((.....(((....))).....)))))((((((..((((.(((.....((((........,...))))..{((({......}.}.,},,..)))))))))))))...)))))))){((((...))))},.}})))),}.)))))).))))))))))))))...|||.}.}}}..(((,{((((((..((((((((....,{{....{|||(((((.((((...((((.(.((((((((((({,.(((.,..(((((((.....((((((................))))))((((.((((((((.((......}),))).)))))..))))...((,{((((((((((....((((((((((((...(((((((((((((((((((((((..(.(((((((((((((((.((.(((((.(((.....)))))))).)).))).))))))))....(((((....)))))((((((.((((((((((.........)))))...))))).)))))),......)))).)..))))))))))}...,))))))|((({...}))){((((((((.(.((((((....))))))..).))).)))))|(((((((......)))))))}...((,...(((.,((((....)))}.,)))..})))))))).))))))).((,{{..,,,.}}.}}.)))))..))))))).))))))((((.((((((((((((((,((({.,,,..((((((.(((......))))))))),))))),.}),,))).....)))))))).)))))))))))......))).))).)),})))).)).).))))...))))..))))).}},}}((((((((.(((.,.{(((((.((.(.((((,....(((((....{((.({....}).))).))))),.)))).)))...(((......(((.(((((((((((((...{.((((.....))))...........{{(((.{(||...},,}))}|{{{{{{{|||..,............(((.(((((((..(((((((....))...)))))..))))))))))........((((((..(((((((........((..(((((((..((((((.(((((.....)))))...))))))))))))).))......))).))))....))))))))))))))}.(((..((((..(((....)))..))))..))).}...)))))))))..)))}.)))......)))..(((((((((......{{,.....,.....)))).)))))..)))))),.))).))))))))..,..)))))))).)))))))))).|.{||||.......,,..,}.}))})..)})))))).)))).))))))),.((.((((...((...))...))))))))))))))))))....,...))),.})))..))).))))))))))})))))).)).).))..)).)).))))|.|((..(((.((((({.((((((......)))))).)..)))))..)))..)))}).)))))))))))))).)))))))..}|{,{((((({((|.....|||.}|}}),),.).)))})))}}..}},(((....((((((((((((((,.{(,(((((((,{.{.((((.((....(((((((..,.,((...........}}}})..))))))).}).)))),..).))))}})).))..,....}).)))))..)))))))...))).,}}}...))))))))...)))).,.,))))))))))).))))).}))).))))..)))))))))))))).}.))))))).((....,,..}).))))))((((((((((.(((.(............})))))))))))))....)),}},)}.))))}}..}}.)))).}}...}).)))...))))))))){((((...((((.....((((((((.((({(((......{{,.|{|,.(((({.{...,,||}|||}...(((((((((,((({((({(.(..{,{(,.((((((,(((......}.}}}))))).,||...,)))..,||.,}}||||,.||||||||.|||,.((((....{{....|||}|{..||||.{,|||.||.,,..))},.,))).|||},.}}.}},.....)))),,..}})|,......}}))))).)))))))).,,,,)))),.,}..))}))|||,|.,||||..,.(({(((((({...((({{((...(((..(((.(((({.(((.....(((....)))......))).})))).))).)))...)))))).((((((((.{{.....})..))))))))}}}}})...})))))))))))...)))))))))})))))))))}.,,{{{{.,,,)))))))))))).).)))).)))((((((((({(.(({(((.,,,....))),))),,)}.))))))).)))))))))))..}}|{|||{,.,|(((..((({(..........))))).,||||,,,|},||,,,|{|{{.,.,,,,))),)))},.})})),,}.}|,{((((...}|||}.....|},....}}({({,,,.}||}....,.}},...|||||,{{{,,||||,((((((,{,(((((({(((,(((({(.{,,..||.....{{|{{|{.||||||||.{{{{||,{{,((((...{(....}}.}}}}}}.,||||{,............{(..((((((.......)))))).}}.))})),}}||,||}.|||}}|,|..||||}}|||}.}}))}......,||||{||...}.}))((((((((((.,{.....,...((((....))))..,..,)).)))))))))),}))}}.}|}.}}}},},.,|||,},}}))))}}}}|,(((..,,))),}}}}}}.,)}}}||||.,}}}})).)}).).})))}}.}}|.{{{((.,(((({{{{,||||.(((((,,{(((,,,{{.{{|||||||,,,.))))))))}))))))||{{{{{{{|||,{..,.|||||,.|||{|((({...)))))),.})))))))|||..{||,},,..),),.)))},,}|,|||}.,,,.},}))))..{{((((((....))))),...,||((((((.,(((.,,,,,,,,{(((((.(,(,....}),))))))),{{.|{||||}|{{|||,||||{{,,,{{,|,||||||||{{{||||.,,.((((.....)))).}}.||..,.{((((,...}))))},,,,{(({,.,..{.|{|{({......||,,.,.{({{,,.,{,.{........}||||{,{||,.,,,)}).).}))))))))((((((..((((.(((.......)))..)))).,.)))))).....{{.((((((((....((,(((..(((..((((.((.((.((((.((((.(((((({((((((.....{.,.,,.{(((((...,((((((((....)))))..(((((((((.....((((((.(((((((((..,(((..((((.....)))).))).,.....)).))))))),.,..((({{..,||...,||,,,.(({...,,|||,.,}}}}}...,))...))))).(((((.........))))).....,((((..{.(((((....))))).}..)))),....)))))).)))))))))......((((((..((..((.,..((..((.((((((....)))))).))...)).,..))..))..)))))).,})},,))))}},...,.},....)))))).))))}.,)).)))).,)))).)).))))))..)))))).)))))))))))),,)))})),)))))})))))))}},}))),||........,,,}.}))},}}}|}||}}),,|||}}}}}}},})))).)))))).,.......((({...))))....,)))),))).,.))})}),,,.,..,,,{|,,..,,}}}.,.,,.}})).

Transcripts

ID Sequence Length GC content
ACCUUUGGCGCUGAGUCGAGGCCAGGAAGGGGCGGUCGAUGAGAGGGCG… 6551 nt 0.6158
Summary

The myosin II molecule is a multi-subunit complex consisting of two heavy chains and four light chains. This gene encodes a heavy chain of myosin II, which is a member of the motor-domain superfamily. The heavy chain includes a globular motor domain, which catalyzes ATP hydrolysis and interacts with actin, and a tail domain in which heptad repeat sequences promote dimerization by interacting to form a rod-like alpha-helical coiled coil. This heavy chain subunit is a slow-twitch myosin. Alternatively spliced transcript variants have been found, but the full-length nature of these variants is not determined. [provided by RefSeq, Mar 2010]

Forensic Context

A study in humans demonstrated that the MYH7B was up-regulated in male arrhythmic sudden cardiac death cases compared to female cases, as part of sex-specific differences in ion-channel and myosin expression identified through transcriptomic profiling of left ventricular myocardium [Caudal et al. DOI:10.1016/j.jacep.2024.08.013].