Basic Information

Symbol
MYH8
RNA class
mRNA
Alias
Myosin Heavy Chain 8 MyHC-Peri MyHC-Pn Myosin, Heavy Polypeptide 8, Skeletal Muscle, Perinatal Myosin Heavy Chain, Skeletal Muscle, Perinatal MyHC-Perinatal Myosin-8 Myosin, Heavy Chain 8, Skeletal Muscle, Perinatal Fetal-Myosin Heavy Chain GtMHC-F DA7
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference

MANE select

Transcript ID
NM_002472.3
Sequence length
6041.0 nt
GC content
0.4782

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1866.70 kcal/mol
Thermodynamic ensemble
Free energy: -1972.99 kcal/mol
Frequency: 0.0000
Diversity: 1428.30
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
................((((.((((...))))))))....(((((((...(((((....)))))((((((....))))))..........((((..(((((....)))))...))))(((((((((((((.(((....(((((((.....(((........)))..)))))))......))).))))).))))))))((((......)))).(((.(((((((.(.((((((((...))).((((.((....)).))))..........((((((..............(((...((..((((...))))..)))))(((((((((...))))))))).....))))))...............)).)).).).))))))).)))..((((((.((((((((.(((.(((((.(((((..((.(((.((.((((((((((...............))))))...((((((.(((...(((((((((.(((((((((.(((((((...(((((......).))))((((....)))).....))))).)).))))(((((.((((((((((.(.(((((((((.(((......(((((((((((((((((....).)))))))..(((....(((((((...)))))))..)))..))).)))))).....))))))))((((.((..((((((...)))))).)).)))))))).).)))).))))..((((((....((((((((((((((((.(((............(((((.((((....)).))...)))))..(((((((..((.(((((........))))).)).))))))).((((....))))...(((((......)))))...(((((.((.((((((((......)))))...(((((((......((((.((((((.(((...))))))))).))))......)))))))..(((((.((((......))))...)))))........(((((((((((.((.....(((...((((((((....))).)))))))))).)))))..(((((((..((......(((.((...(((((((((.(((...)))))))))))).)).)))((.(((((((((..(((...(((......)))...))).)))))...)))).))))..))))))).......(((.((.......)).)))))))))))).)))))))..(((......)))((((......))))..))))))))))))....)))))))(((.((((((..(((..((...(((....)))...))..)))..)))))).))).......)))))).((((((.....)))))).)).)))))(((((((((((...((((((((((.(((....))).))))))))))(((((...(((.(((((.(((((.(..((....(((((((.....(((((((((((((((.(((...((((...((((((((...))))))))))))(((((((.(((((...((..((((......(((((((((...)))))))))............((((((((...........))))))))((((.((((((....(((.(((((((.(.((((.(.(((..(((((((((((((..((((.(((((((..((((.(((.((.((((((...((((((..((((((((..((((((....)).))))..)).)))))).........(((...((((((.(...(((((...((((........)))).))))).).))))))..)))....((..(((.(((((.(((((..((((((.((((((...(((........))).....((((((((((.........(((....))).........(.((((........)))).)(((((.......)))))))))))))))((((((((......(((((((((...(((((((.((((..((((((.(((.((.......)).))).))))))...).))))))))))((((...))))..................(((((..(((((((.(((((((((..(((((((...((((((.(((.....(((...(((...(((...)))...)))..)))......))).))))))...)))))))....))))).(((((((((((..((((((((.((((....))))...))))((((((.(((.................))).))))))....))))..))))).))))))..(((((....((((...((((((((((((((......((((((((((((.((((((((..((((.((((.......(((((.....)))))..(((((((..((..(((((....))))).)).)))))))))))..))))...............................(((.((..((((.....))))..)).)))..)))))))).))))))....)))))))))))).))))).)))...))))....)))))))))))))).)).))))))))))))))((((((((...(((((((((..((((...((((((((((......(((..(((......((..(((((........((((...))))....................(((........)))....((((..(((((...(((......(((((.(((((....)))))....)))))......))).)))))..))))((((.....)))).(((.((((.........)))).)))....((((........))))........)))))...)).....)))..))).......)))))))).))....))))....((((((...((.((....((......))...)).))...))))))...((((........)))).(((((((.(((......)))))))))))))))))))...))).))).))......((((.....(((((......))))).....))))(((((...............)))))..)))))))).((.((((...)))).)).))))))....(((..((((((((..(((.((..(..(((.((((......))))....(((....(((((((.......((((........))))...(((.((((((((..........(((((((.....(((((......(((.((((......((((....))))........(((...(((((...))))).))).............(((((((..(((....(((............((((..(((..((((((........))))))..)))...))))((((((........)))))))))....)))..)))))))....)))).))).....)))))........)))))))......(((.(((((.(((..(.(((.....((((.((((((.((((.((((...)))).)))).)))..)))..)))).......))).)..)))..((((((.((((......)))).).)))))))))).)))..)))))))).)))((((((((.(((.....)))...)))))).))....(((((((.((.((((.((((....))))...)))).)).))))))).)))))))..)))...))).)..))))).))))))))..))).)).))))...))))).))))).)))..)).((((....((((.((((.((......)).)))).))))))))....(((((....))))).........(((((((.((.((...)).)).))))).))......)).))))))))))))..))).))))..))))))).))))..))...(((((..(((((((........)))))))....)))))..(((((...((((..((((((((....((((..........)))).....)))))))).))))...)))))...((.(((....))).))..((.......))...((((.(.....).))))......(((((..(((((..((..(..(((((......)))))..)..))..)))))...))))).))))..)))).((((.....((((((((.....(((((((.(((.((((..((...))..))))...))).....((...((.((((((.(......).))))))))...))........)))))))))))))))......)))).)))..))).).))))).))))))))))...)))))).))))..))))..)).))))).)))))))......))).)))))))).(((..(((.(....).)))....)))((((..((((((((((((.........((((.(((....))).)))).((((..((..(((((.....((((....))))(((((..((((((((((((.....(((((....((((((((((..((((.((.((.(((.((.................))))).)).)).))))....)))))).)))).........((((((..(((((...))))).((((.((..(((...)))..)).))))........((((.....))))............))))))....(((((((..(((..........(((((((....)))))))..))))))))))...................(((((((((((((((((.(((((.((..(((...((((..(((........)))..))))....)))..))...))))))))(((........((((((....)).))))........))).....))))))))).((..(((((.(((.......))))))))...))...............(((..(((.........)))..)))((((((.(.((....)).).))))))))))).(((((...))))).(((((...((...))..)))))..((....)).))))).((((((........))))))....))))).)))))))...)))))(((..(((((...))))).)))...))))).))..)))).))))))).)))))))))..(((((.......)))))................((.....)).((((((((...)))).))))((((((((((((((...............((((((((...................((((......))))...........((((..((((........))))....))))(((..(((..((.((..(((.....)))..)).))..)))))).)))).))))))))))))............))))))...(((((....)).)))))))))).....))))).))((((((((..(......)..))))))))...))..))).))).)))))...))).)))))............(((((...))))))))))))))))....))))).)))...))))))...)))))))))......)))).))))).))..)))))))))).............((((......))))..........((((.(((.(((....).)).)))))))))).)))).)))))))))).....(((((..((((((((.(((((.((((((..(((...(((.............)))...)))..)))..........(((((.(((((((....)))))))..((((..(((...(((.......)))...)))..))))......))))).(((..(((((....))))).)))....(((((.((((.((......))))))))))).....((((.(((((((((..((((((...)))))).))))))))).))))))))))))..)))))))))))))....((((...............))))))))))).........
Thermodynamic Ensemble Prediction
..,{{,,,,.......((({{{(((...))))))))...{(((,{,,...(((((....))))){||||....(((((({......,,{.((((..(((((....)))))...)))),|||(((((((((.(((..,,(((((((.,...(((........))).,))))))).,,...))).))))),})))||}|{.((((...((({...((((((.(((...))))))))).....})))....)))),,..,,..))))}}}..{|(((({{{,,{{,{{{{{,{.,,{{,({(((((...)))),.)).))|((((((((...))))))))},,...,|||||....,........,,}}})).|,|.(((.((.{{{.,.((((((.((((((((.(((.(((((.(((((..((.(((.({.((((((((((..{........,...})))))...((((((.(((...(((((((((.(((((((((,(((((((...,((({,.{{{{|.||||{(((....,}||.....}}))).)).))))(((({.{,((((((((.(.((((((((,,(((......((((({{{{((((((((....),,))))))..(((.{..(((((((...))))))).,)))..))),)))))).....)))))))}{(((.{{..((((({...}))))).}}.)))))))).).)))))))))..((((((....{(((((((((((((({,(((.......((((((((((.((((....)).))...)))))..(((((((..,(.(((((........))))).)).)))))))..(((,,,{||,,...{((((|,....,}}|||,,,{{{{.{{{|,,||{{{.,,...,,})),..||{{{{{,.....((((.((((((.(((...))))))))).))))......}}))}}}..||||{.||||,....,)}}),,,))))),},,))}.(((((((.{((,{,.....(((...((((({{(....})).))))),}))}.}{{{{{{(((((((,,,,,{{{{.(((.({...(((((((({{(((...)))))))))))).)).))),(,{{{,{,,||,,|||...,,|..,,,,.,,...}}}.},))))))))))},}.|||||}},,),))}....,..((....}}.},})}))))))).}|||,(((....))).,,,..,,.{|||....,,)))),.)))))))))))),...))))))}(((.((((((..(((..((...(((....)))...))..)))..)))))).))).......)))))).((((((.....)))))).,}.)))))(((((((((((...((((((((((.(((....))).))))))))))(((((...{({.(((((.((({(.(..({....(((((((...,.(((((((((((((((.(((...{{{(,,,((((((((...))))))))})))(((((((.(((((...((..((((......(((((((((...))))))))).....,,.,.{{(((.{{{..,,))).}.},,}}.||{{,,((,((((((....(((.(((((((.(.((((.{.(((..(((((((,{,(((,.((((.(((((((..((((.(((.((.((((((,,.((((((..((((((((,.((((((....)).))))..))}}))))).........(((...((((({.,,(((((((...((((........)))).))))},))))))))..)))....((..(((.(((((.(((((..((({{,.{(((((,..{(({........}}.....((((((((((,........(((....))).........,.{{{{,,,.....,))).,{((((.......)))))))))))))))((((((((......(((((((((...(((((({,(((({.((((((.(((.((.......)).))).)))))).,.}.)))))))))}(((....})))..,{{{,....,,,}}..{((((..{{(((((.(({(,,(((||({,{((||,,(((((.{(((({({,.,{|..,,.....,|.|,)}}.}}))},{{{|.....,))||||||||...,,}))))},,}}|}||{(({{{,|||||,,|||{|{||,{|||,,,,,|||,..|||||{((((.,.{{{{,...,,,..,.,,}}}....||||,...,}||..,})),.,}||||{{(,,(({(,.,(((,..((((((((,,(({,..,,..|||}}}||,,{,.,{{((((({{......|))}}}}.,.{((((.....))))}..,,,,,||},||}}|,,||}}}})}|||{||.|}}}},.},}}}}}},,.....,,,{......................|||,||}}|{{||,,.}))),.,))|)))..|||||||,.,))))}|{{..|||||||,,,|.)))))})}}.,.|||}....}}}|}})))))))).}}.))))})))))))))((((((((...(((((((((,.{{{{...((((((((((.,....(((..(((......{{..(((((........((({...})))..............,...,,((({{{{....,||....((((..(((((...(((......(((((.(((((....)))))....)))))......))).)))))..)))).,||.....))))}||,.|{{{....,....}|||.,}}....{{{{........,,)),....,,.)))))...}}.....)))..)))......,)))))))).))....}|||,,,{((((((...{{.{(....,{......}}...}}.}}...))))))...{{{{......,,)))),{((((((.(((,....,)))))))))))))))))))...))).))).))......{{((.....|||||......)}))}||{{{},}|{{{({....}}}},|,...,})}}}..})}}}}}}.{(,((({,..)))},)}.||||}}....(((..((((((((..((({{(,,,{,{...|||,...}}})},}|...(((....(((((((....,.,{,,{,,,..,{{||},..}|||}(((((({(..........(((((({.,...((({{......({,.(({{...,,.((((....))))....,.||(({...(((({...})))).}}}.............(((((((..(((....(((............,{({..(((..((((((........))))))..)))...))),((((((........)))))).,,....)))..))))))).,,|||}|.}}}....,})}||,,......}}}}}}}.,,,..{((.(((((.{{{..{.|||....,|{{{.|||||{,|(((,(({{...)))).)))).}}||,.,}..)))).......))).)..)))..((((((,(({,.,....}}}}.).,))))))))),})}..}))))))).,}|((((((((.(((.....)))...)))))).))}...(((((((.((.((((.((((....))))...)))).)).))))))).)))))))..)))...}}}.}..,)))).))))))))..))).,),))))...))))).))))).)))..)).(((({,..{{((.((((.((......)).)))).))))))))....(((((....))))).........(((((((.((.({...}).)).))))).))......}).,)))})))))))..))).))))..))))))).))))..||.,,{,{,||.(((((((........)))))))....|{(((,.(,,,,.,.||||},,{{{(((({,{{{((({,{{{{{,,,||}|{....,,)),))).,|||,,.,,)))..}}))))}....||.....,,,,..,,.,})}}}}}|......|||,|||},,,,{{((((((((,(..,.(((.(..((((..(((..(({.....,.))}..)))....))))..))))...}..).)))))},.|||||{||}||}.|||{{{{.,|,.||||,}||..,))..}}}}...,.,.....||...((.((((((.{......}.)))))))).{{|{{{......,))))))))))})))})}.,.)))).)))..))).}.))))).))))))))))...))))))}))))}.))))..)).))))).)))))))......))).)))))))).((({{(((.(....}.)))....}}}((((..((((((((((((.........((({.(((,...}))})))).((((..((..{((((.....((((....)))),((((..((((((((((((..,..{{{{({{{{(((((((,((,{({{({({(((,{{{,{,,,..{{{{{...{(({{{||||{,,.||,|||.....,||.....,}}.........,,|||,..||||.}}})))),.((((.((..(({...}))..)).))))........{{{{....,}}}}............)),}})....,|}}}}},,)))}}..}}},,.(((((((....))))))).{|||||||||},.|,,..,|,,.......||||{|({{((((((,((.(((((.((..(((...((((..(((........)))..))))....)))..))...)))))))}|||........((((((....)).))))...,..,.|||,||,.}))))}})).,,..{{{{..{{{.......)))))))}..,))...........,...|{|..|||,.......,}}}..})){(({{{.,.,|,,..,}.)}))))}))},},|{{{{...{|..{{.(((((...({...)}..))))).}|,...,),,))))).((((((.{,...}})))))),},.))))).)))))))...))))|(((..(((((...))))).))),..))))).))..)))).))))))).)))))))))..(((((.......)))))....,,..,.......((.....)).((((((((...)))).))))((((((((((((((........,......,{((({,{............|,..,..,.....,..,}}}}....,......((((..((((........))))....)))),,,..(((..((.((..(((.....)))..)).))..))),||{|},.})))})))))))),...........))))))...(((((....)).)))))))))).....))))).))((((((((..(......)..))))))))...})..)}).))).)))))...))}.)))))............(((((...))))))))))))))))....))))).)))...))))))...)))))))))......)))).))))).))..))))))))))..........,..((((......))))..,.......(((,,(((.(((....),,).)))))))))).)))).))))))))))...}}}))))).|,|{{{,..{|||,...{{{,..{{{,.,{(,{{{...(({....)))...)))..)))..........(((((.(((((((....)))))))..((((..(((...(((.......)))...)))..))))......))))).(((..(((((....))))).)))....(((((.((((.((......))))))))))).....((((.(((((((((..((((({...}))))).))))))))).))))))))))),.}})}}))))))),}....{{{{...............}})}.}})))}.........

Transcripts

ID Sequence Length GC content
AUUUCCACCAAGAACCCAGAGAGUGGAACACUUCUGAACCUGCAUUUUU… 6041 nt 0.4782
Summary

Myosins are actin-based motor proteins that function in the generation of mechanical force in eukaryotic cells. Muscle myosins are heterohexamers composed of 2 myosin heavy chains and 2 pairs of nonidentical myosin light chains. This gene encodes a member of the class II or conventional myosin heavy chains, and functions in skeletal muscle contraction. This gene is predominantly expressed in fetal skeletal muscle. This gene is found in a cluster of myosin heavy chain genes on chromosome 17. A mutation in this gene results in trismus-pseudocamptodactyly syndrome. [provided by RefSeq, Sep 2009]

Forensic Context

A study in human prostate tissue demonstrated that the MYH8 mRNA was upregulated in samples with a late ischemic time (>1000 minutes) in an independent validation cohort from the GTEx database, identifying it as a classical muscle-related gene whose increased expression is associated with prolonged postmortem intervals [Javan et al. DOI:10.1038/s41598-025-29561-7].