Basic Information

Symbol
MYH9
RNA class
mRNA
Alias
Myosin Heavy Chain 9 NMHC-II-A NMMHCA EPSTS FTNS MHA Cellular Myosin Heavy Chain, Type A Nonmuscle Myosin Heavy Chain II-A Non-Muscle Myosin Heavy Chain IIa Non-Muscle Myosin Heavy Chain A NMMHC-IIA Myosin-9 DFNA17 Myosin, Heavy Polypeptide 9, Non-Muscle Non-Muscle Myosin Heavy Polypeptide 9 Myosin Heavy Chain, Non-Muscle IIa Myosin, Heavy Chain 9, Non-Muscle Non-Muscle Myosin Heavy Chain 9 Nonmuscle Myosin IIA2 NMMHC II-A NMMHC-A BDPLT6 MATINS
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_002473.6
Sequence length
7451.0 nt
GC content
0.5830

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2912.70 kcal/mol
Thermodynamic ensemble
Free energy: -3030.10 kcal/mol
Frequency: 0.0000
Diversity: 1587.29
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((.((......((((((((((.(((((((((..(((......((((......(((((..((((((.((((.(((((((........(((....)))))))))).))))..........))))))..)))))))))(((((((((((...((((((....(((..(((((....((((...)))).(((((.(((((((.....(((((......)))))................((((((.((((.((((..((((((.((((....(((((..(((((((((((..((((((((((((((..(((.(((..((((...)))).))).)))...)))))))).((((.((.((((....((((.((((..((((.((.(.....((....((((.....))))...))(((...((((((((...))))))))..)))...((((.((((((((..(...((((..(((((.(((((.(((...((((.((.......)).))))...............(((..((((((((.((........)).))).)))))..)))..((......)).))).))))).)...))))..))))..)..)))))))).)).))))).)))).))).).))))......)))))))))).(((...((((..............)))).))).))))))....(((((..((((............))))...))))).))))).))))))....))))).....))))))))..((......)).))..)).)).)))).))).))).))))))))))))..))))))))....)))))).))).)))))))))))....)))))........((.(((((((.((((((((((..(((((.((((((....)))))).))))).....))))))))))...((((..(.(((.((((((((.((...((((((..((((.....(((..(((((.......)))))...(((((.....(((((.(((...))).)))))......)))))(((.(((((((..(((((.(((.......))).)))))((((((.((((........))))....))))))..(((((......))))))))))))...))).))).....))))))))))..)))))))))).)))).)))).((((((((((((((..((..(((.((((((((((((...((((((((((......(((((((........))((((.(((((..(((....((((..(((((((.(((((...))))).)))))))....)))).((..(((((((((.((..(((.((((((((((.........(((((......))))).((..((((((...........(((.......)))......(((((....))))).(((..(.((((((...)))))).)..))).)))))).)).....(.((((((......)).)))).).(((((((((((((.((((..(((((((...((((((((((.(((((...)))))...((((((((((((....))).)))........))))))...(((((((((((((............((....(((((.(((..(.(((.(.(((((((((((.((..((((.((......)).)))))).))))((((((((((((((((....((((.((.((..(((((...((((...))))...)))))....)).)).)))).((((((((((((...((((........).)))((((((....((((((((((((((.(((......)))...))))(((..((....))..)))..((((((((.((...((.((...(((((((.((....)).)))))))......)).))...(((((.((((.....(((((....))...)))....))))))))).((((((((((((....)))........((((.((((((.(((..((.(((((.((((((..((((((..........)))))).))).)))...)))))))..))).)).)))).))))((((((.......))))))...)))))))))((((....))))((((((((((......)))))).)))).((........)).)).)))))))).)))))))))).....)))))).......(((.(((.((.(.(((..((((((((..(((.((((((.(.((((....((.(((((((((.(((((((.(((((..(((((((((((((..((((((((((((((.((((((....(((((((.((((((((.(.((((....(((((((......(((((.(((.(((....((((((.((..(((.........))).(((((((((..((((..(((((.((((.(((((((........(((((((((.........(((((((.((((((.((.((..((..((((((((((..(((.............)))..(((..((((((.((((.((.(.((((..((.((((..(((((....))))).....)))).)))))).).)).)))).))))))..))).((((((.(((....(((((.......)))))))))))))))))))....)))))..))..)).)).)))))).)))))))))))))))).....)))))))........(((((((.....((.....))....)))))))))))...)))))(((.((....)))))..(((((((((((.(((...))).))))..))))))).(((...(((((((..((......))))))))).)))....))))..))))))))))).)))))).)))))).))))).((...((((.....))))))..........(((((((((((....((((..((.(((((.((..(..((((..(((.............))).))))....(((((..((((...))))..)))))...)..))..)))))))(((...(((((((.((......(((....)))..(((((..(((.....((((.(((...(((((.((.((((...((.((((.........)))))).))))...))..))))).(((..(((.....)))..)))........((((......)))).(((....))).((..((((((...((((.....(((((((((........))).)).))))...)))).(((((....))))).......))))..))..))((((....(((.((((...)))).)))...)))).....)))))))...))).)))))(((((((..((.......))))))))).)).))))))).)))...............))))...))))))))))).))))))).((((.....(((...........)))))))...........))))).)).)))))).))))))))))))).))))))))((((((((.(((((((((((((.......(((....)))..........((((.((......)).))))(((((....)))))))))))).))))))))))))))...((((...))))..(((((.((....)).)))))((((........)))).......))))))..)).)))))))..(..((.(.((..((...((((((...((((((....)).))))....)).))))))..)).).))..)..)))).)))))....)))))))........))))))))).))...)))).(((((.........)))))).)))))))))))))))))..))).).)))))..)))...)))))))...)))))..((((............))))...)))))).))))))))))............((((((...((.(.....(((((.(((.....)))((((........))))..(((((((...((...((((((........))))))...))..))))))).))))).....).)))))))))))))))).)))).))).)))))....)))))))))))))))..))))..))))))...(((..((.(((((.....))))).)).)))((((..(.....)..)))).)))))))....)))).)))))))).(((((....((.....(((......)))...))...))))).)))))...((.((..(((..........)))..)).))))))))))))...)))..)).)).....))))))).))..((((((...((.(((..((((((((.((((((((((.(((.....(((..((..((.......((((.((..(.(......))..)).))))(((((((((.(((.((((((((((.......)))))))).((((.((....))...))))...............)).))).)))))))))((((((((.(.....).))))))))..((.(((........)))))((((((........))))))..))..))..)))....))))))))))))).))))))))..)))...)).)))))).....(((((((((....(......)...))))))))).)))..))))).).))).....))))).))))))))))(((((....))))).)))))))))))).))).))..)))))....)))))))))))))))).))..(((((((((((.(((.(.((((((((((((((.((...))(((((((((..(.(((((.(((.(((((((.((((((((((...(((((((((((((..((((..(((((((((((....((((((..(((..........(((.(((......))).)))(((((..((.((((..((....(((((((.(((.((((((......(((((((((.((((((......))))...(((.((((..((.((.((((((((...(((.(((((..........))))).))).....(((..((((((((.(...(((((.((........)).)))))).))).)))))..))).....)))))((((.....))))))).)))))))))))................(((....))).((((((((.((.....((((((.(....).))))))(((((..((..(((.((..((.((..((...)).)).)))).)))..)))))))(((.(((.((.((((((((.((.(((((((...........((((((..(.((((.((((.((((((....(((((((.((.((((((((((((((.((((((((((.......(((((.........))))).......))...))))).((((.....))))...............((((.(((......))))))).....((((....))))(((((((..((((.((((((....(.(((((......))))).).((.((((((((.(..((((........).))).).)))))))).))((((((((.(..........(((.(((((((.(.(((.(((....(.(((...((.(((...(((((((((....)))))...(((...))).....(((((..(..((.((((((.(((((((....((.(((......))))).................(((.....)))......))))))).)))))).))..)..)))))(((((((((.((((.((((((((.(((((.........))))).))...((..((.(.(((((((....(((.........(((....))).......)))...))))))))))..))......((((((((((((...(((((.(((((((.(((...((...((((((.....)).))))))...)))..)))))))..)))))...((...))(((.((((((..(((.......))).....)))))).)))))))).))))))).((..((......))..)).....)))))).))))........(((((((.(....((((.........)))))))))))).....)))))))))))))...))))).))).)....))).))).)))))))).)))).)))))))).)))))))))).))))))).))).))))))))).))))))).)))..(..(((........)))..).)))).))))))..........((.....)).((((((...(((((..((((((....((((.....))))..)))))).))))).((((((......))))))(((....)))..(((.......)))....((((...(((....)))))))))))))...((((.((((((.....)))))).))))..)))))))).)..))))))))))))))))))))))).)).)))...)))((((........))))(((((.(((((((((.((((..((...))...)))).))))))..))).)))))..)).))))))))..(((((((...))))))).(.((((((.((((((((((......)))))))).))...)))))).).))))))))))))))))).)))))).............)))).....))..))))))))))).(((((....)))))...)))..))))))....((..(((((((((((((..(((((((.(((.....)))))))))))))))).(((((.....)))))(((((...........)))))...(((((((...))))))))))))))...))......((((((...))))))))).)))...))))))))).)))..)))))))))).....))))....))))))..)))))))(((..............)))))).)))))).)))))))))((((((........))))))..........((((((.((......((((((.....(((.....)))......)))))))).))))))))))))))))))).).).))).....(((((..((((........)))).)))))(((((((((((((.((.((((((......((......)).((((((((....)))))))).....))))))(((((...)))))......)).)))))....))))))))((((....))))..)))))))).))).....(((((.......)))))..)))).))).(((((.........)))))(((....)))((((...(((((..(.........)..)))))...))))(((((((......))))))).......)).))))))).)))..
Thermodynamic Ensemble Prediction
(({.{,....,.((((((((((.(((((((((..(((......((({......(((((..((((((.((((.(((((((........(((....)))))))))).))))..........))))))..))))))))}(((((((((((...((((((....(((..(((((....{{{{...}))).((((,,(((((((...,{{,,{{,,..{{||||.......,.........|||(((.((((,({((..|||)|}}((((....((((({{(((((((((((..,{{,({((((((((..(((.(((..((((...)))).))).)))...)))))))),((((.((.((((..,.((((.{(((..((({.((.,.....((,{..{|||,....}}}}..,}}({{{{.((((((({...}))))))).})))...((((.((((((((..{...((((..((((,.(((((.(((..,((({.{,.......||,}}}}.......,,,.....(((..((((((((.((........)).))),}))))..)))......,,,},,.))).))))).,...))))..))))..}..)))))))).)).))}})})))).))).}.)))),.,...)))))))))).(({...(({(.,............}))}.))}.))))))},..{((((..((({...,|....}}.))))...))))).))))).)))))).}},)}))).....))))|{{(({((......))..).,))}),.)))).))),))}.))))))))))))..))))))))....)))))).)))}}))))))))))....)))))........((.(((((((.((((((((((..(((((.((((((....)))))).))))).....))))))))))...((((..(.(((.((((((((.((...((((((..((((.....(((..(((((.......))))){(((.((((....(((.((((((((((.(((.((,{,...{.,{,....})}},,}},(((((.(((.......))).))))),(((((...)))))..,,.))).)))))))))).))),..)))).))))(((({{...}}.)))))))...}.))))))))))..)))))))))).)))).)))).((((((((((((((..((..(((.((((((((((((...((((((((((......(((((((........))((((.(((((..(((....((((..(((((((.(((((...))))).)))))))....)))).((..(((((((.({({..{||}|{{(((((((......,|}(((((......))))).,,..(({({{.{,.....||.(({.{,.{{{|||.{{.,{({((({{{{,}|||.,{{..{.((((((...)))))).}.|)))|))}})).}}.....(.((((((......)),,))).).||||}((((((((.((((..(((((({..,(((((({(((.(((((...)))))...((((((((((((....))).)))}.......,)))))...((((((((((((({...........,|,...(((((.(((..(.(((.(.(((((((((((.((..((((.((......)).)))))).))))((((((((((((((((,{.{((((.(({....((((((...((((((({{{...||,))}},{||.}.{||||.|(((((({({,{{..,{{{.,{.....,.,||((((((....((((((((((((((.(((......)))...))))(((..((....))..)))..((((((((.((..{(({.(((((.(((((.((.((((...|{|....,}...)))).}}))))).})))).})},,{.((....)),|.,||....}})},||{{{((,{(((({{(((,({..((({....})))..})||||}|||}.}|.||||}.((((.({.,,(((((.(..(((((((((({.,.,,)))...)))),))).,),})))),,,..)).}}}),{{({{.((((((((...)))))))))||||....,,,,((((((((((......)))))).)))).((........,}.)}.)))))))).))))))))}).....))))))}.....,|||}||..((|,.((((((.,.((((.(((..((((((((.((((..{(((.(((((.(.(((.((({.{((((,,(((,,(((((((((..((((((((((((((.((((((....(((((({.((((((((.(.((((....(((((((,,..{{(((((.(((.(((....((((((.{{,,,{,..,,.....,||{({(((((((..((((..{({{{.((.{.(((((((...,....(((((((((.(((((((.{{((((({{,((((.((.(((.,,,.(((((,,,(({.((....}}.}})...))))}.|.,.}}},||.}}||{|{{...{|||}.||..|||.,,,|||..,,((((((.((((.{{.((((...{.,|...,},},))))}})))))))))){((({{.{((.(({(...{{{{.,||||||,},..},)))}}}.,))),.,))}),})).)))))).))))))))))))))))..}..))))))).,.}}.,,((((({(.....{{.....,..,|,|}}||||||||.,..|,|{(|{.{{,.,.|||||.,(((((({((((.(({...})).)))}..})))))){((.,,,|||||}|}.,|},....})}}})))),,)),},.))))..))))))))))).)))))).)))))).)}}||,{{..,,....,...})))},,,,,}}}...(((((((((((.,,.({{{..((.(((((.((..{..((((..(((.............))).))))..,.(((((..((((...))))..))))).,.}..))..)))))))(((...(((((((.((.,....(((....}))..((({{,{((,....,|||{{,((.,,(((((.((.((((...((.((((.........)))))).))))...))..))))).(((..(((.....)))..))).,,.||..((((......)))).||{....}}}....|||||,|,..((((.....(((((((((........))).)).))))...)))).(((((....)))))....||,||,,..},.}}|((((....(((.((((...)))).)))...)))),....))))}}),..}},.))))}(((((((.,{,......,}}))))))).}).))))))).)))...............))))...))))))))))).))))))).((((.....({{,,........})))))))........,..))))).)),,))))).))))))))))))).)))))))){(((((((.(((((((((((({.......(((....)))..........((((.{(......)).))))(((((....)))))))))))).))))))))))))))...((((...))))..{((((.((....)).))))}((((........)))),......))))))..)).)))))))........,..))),}}}}}.,.))},.((((((....)).)))),..))).),))))}}))))))).))))))))..))))))).))))))...}))...}|||}||,.|||...}}.,.{|||,,.,....,,))))))).))))))))).)))))},..{((((.{{|,{{,,|...,,),.))))})))))..((((............))))...)))))).))))))))))..,,,,......(({((((({.{{{||...,,({(((((.....))))},|..}},}},,)}|..(((((((...{(,..((((((........))))))...}}..)))))))..}))).))..||},,},))))))))))).)))).))).))))).....))))))))))))))..}},}..)))))),..(((,.((.(((((.....))))).)).}}}{(((,,{.....,..}))),)))))))....)))).)))))))).||,||}},,|,....,||{},...,))),,}))}..|||||,|||||,,{{{.{{.,({{..........}}},.}}...))))}))}))|||)),..,,.)},}}}.))))))).))..((((((...{{.(((..((((((((.((((((((((.(((.....(((.,((.{((.......{(((,{{..,.|,.....||..)).)}}}{((((((((.(((.,(((((((((.......)))))))),((((.((....))...))))........,......,),))).))))))))|((((((((.(.....).)))))))),.,,.|||......}})}.,}((((((........))))))...,..))..}))....))))))))))))).))))))))..)))...}}.)))))).....(((((((((....,......,...))))))))).)))..))))).).))).....))))).))))))))))(((((....))))).)))))))))))).))).))..)))))....)))))))))))))))).))..(((((((((((.{((.(,((((((((((((((.,{,...{(((((((((..,.(((((.(((.(((((((.((((((((((...(((((((((((((..((((..(((((((((((,.,.((((((.,(((,,........(((.(((......))).)))(((((..((.((((..(({.(((({{(((.(((.((((((......(((((((({{((((((......))))...{((.((({..((,({,((((((((...(((.(((((..........))))).))).,...(((..((((((((.{...(((((.((........)).)))))}.))).)))))..))}.....)))))))|,,,.|||...,))}||||}}})))}................(((....))).{(((((((.((.....((((((.(....).))))))({((({,{{.,{{{,{{..||,||,,{({{.||.}}.))}),})}.,)}))))}{{(.(((.((.((((((((.((.(((((((...........((((((..(.((((.((((.((((((....(((((((.((.((((((((((((((.((((((((((.......(((((.........))))).......))}..})))).((((.....))))...........,...((((.(((......))))))).....((((....))))(((((((..((((.((((((....(.(((((......))))).).((.((((((((,(..((((........).))).},)))))))).))((((((((.{.........,(((.(((((((.(.(((.(((....{.(((...((.(((...(((((((((....))))).,.{{,...}},.....(((((..(..((.((((((.(((((((..,.((.(((......))))).................(((.....)))......))))))).)))))).))..)..)))))(((((((((.((((.((((((((.(((((.........))))).))...((.((((....)))).}}..,((,..,..,..((|....||,......,)),..})},))}},,,...,......((((((((((((,..(((((.(((((((.(((,{.((,...{((({.....)),)))))))..)))..))))))}..)))))..,((...,}(({.((((((..(((.......))).....)))))),)))))))).))))))).{(,.((......}}..)),,...)))))).))))........(((((((.,.,..,,{{.,.......))),,))))))).....)))))))))))))...))))).))).,....))).))).)))))))).)))).)))))))).)))))))))).))))))).))).)))))))))))}))))).)))..{..(((........)))..,.)))).))))))..(((...{{,{.{{{{{.{((({{({{,(((((..((((((....((((.....))))..)))))).))))).((((((......)))))),,(,,,.,,,..{{{.......,,,...,||||}}}|||}.}}))).))),,,)))...((((.((((((.....)))))).))))..)))))))).}..))))))))))))))))))))))).)).)))...}|}((((....},..))))|((((.({{((((((.((((..{{...))...)))).)))))}..})).))))}..)).)))))))}{{(((((((...))))))}.}}((((((.((((((((((,....})))))))).)),..)))))).}.))))))))))))))))).)))))).............))))).,,,}}..)))))))))))}|({{|....}}))|,,,))),,})))}},.,.{{..|||||||((((((..{(((({{{(((.....)))))))))))))))).(((((.....)))))(((((........,..)))))..,((({{{{,}}),,,||||||}||}...))}}},},{(((((...))))))))).)))...))))))))).)))..)))))))))).....))))....))))))..))))))){{{..............)))))).))))),.)))))))))|{{{{|.......,|}}}}),,........{(((((.(({,,{,.{{......,..(((.....)))......})))}))).))))))))))))))))))).}.|,}}}.....{||,,..{{{{.....,,.)}}).,,,,,(((((((((((((.((.((((((.,,...{(.....,}}.,(((((((....}))))))}.....)))))}(((((...)))))......)).))))))},..))))))).,{|....))),},)))))))).))).....(((((.......)))))..)))).))).,,{(({{{,...,,))))|(((....))){(((...(((((..{.........}..)))))...)))}(((((((......))))))).......)).))))),),))}..

Transcripts

ID Sequence Length GC content
GCAGAUCACCGCGGUUCCUGGGCAGGGCACGGAAGGCUAAGCAAGGCUG… 7451 nt 0.5830
Summary

This gene encodes a conventional non-muscle myosin; this protein should not be confused with the unconventional myosin-9a or 9b (MYO9A or MYO9B). The encoded protein is a myosin IIA heavy chain that contains an IQ domain and a myosin head-like domain which is involved in several important functions, including cytokinesis, cell motility and maintenance of cell shape. Defects in this gene have been associated with non-syndromic sensorineural deafness autosomal dominant type 17, Epstein syndrome, Alport syndrome with macrothrombocytopenia, Sebastian syndrome, Fechtner syndrome and macrothrombocytopenia with progressive sensorineural deafness. [provided by RefSeq, Dec 2011]

Forensic Context

A study in mice demonstrated that methamphetamine treatment induced inflammatory bowel disease-like pathology, with RNA sequencing of ileal tissue identifying 326 differentially expressed genes, including the MYH9 which is associated with focal adhesion and actin stabilization [Sun et al. DOI:10.21037/Atm-20-7741].