| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUCCCGGCUUCCAACCGCGCGGAGCCUCUGCCUUGGAGAUUCUCAGUG… | 1911 nt | 0.4537 |
Arginase catalyzes the hydrolysis of arginine to ornithine and urea. At least two isoforms of mammalian arginase exists (types I and II) which differ in their tissue distribution, subcellular localization, immunologic crossreactivity and physiologic function. The type II isoform encoded by this gene, is located in the mitochondria and expressed in extra-hepatic tissues, especially kidney. The physiologic role of this isoform is poorly understood; it is thought to play a role in nitric oxide and polyamine metabolism. Transcript variants of the type II gene resulting from the use of alternative polyadenylation sites have been described. [provided by RefSeq, Jul 2008]
A study in porcine skin exposed to bromine vapor demonstrated that the ARG2 transcript was significantly increased at 6 hours, 48 hours, and 7 days post-exposure for both 7- and 17-minute exposure durations, with fold changes ranging from 4.366 to 9.5, and it was involved in significantly altered signaling pathways including IL-10, IL-17, Hepatic Fibrosis/Stellate Cell Activation, and Glucocorticoid Receptor Signaling [Price et al. DOI:10.3109/15569527.2010.546003]. Another study in porcine skin exposed to thermal burn injury showed that the ARG2 transcript was significantly increased at 7 days post-exposure [Price et al. DOI:10.080/15569520903097754].