Basic Information

Symbol
ARG2
RNA class
mRNA
Alias
Arginase 2 Arginase-2, Mitochondrial Kidney-Type Arginase Non-Hepatic Arginase Arginase, Type II Type II Arginase Arginase II EC 3.5.3.1 L-Arginine Amidinohydrolase L-Arginine Ureahydrolase Nonhepatic Arginase Kidney Arginase EC 3.5.3
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Wound age identification

MANE select

Transcript ID
NM_001172.4
Sequence length
1911.0 nt
GC content
0.4537

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-564.20 kcal/mol
Thermodynamic ensemble
Free energy: -600.66 kcal/mol
Frequency: 0.0000
Diversity: 510.15
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......(((((((......).))))))..(((.((((.(((((.((....)).))))).((((((((((.(((((((.(((((((((.....))))))))).).......((((((((((((...(((((((((.((((........)))).)(((((....)))))...........))))))))..(((((......)))))....(((((((((((((((((((((.(((.((((((((((.(((((........((((((.((((.((((...)))).)))).))))))....((.(((((......)).))).))..((((.((((((.(((((((.....)))).))).))))))))))...(((.(((((((((....))).)))))).))).....(((.......)))..(((........))).......)))))...)))))).))))...)))))))((((((((((((((....)))))....))))...)))))...........)))))))(((....)))......))))))))))))))))..)))).))....(((((...(((.((((..(((((((((...)))))).(((.(((.(((((.......((((...)))))))))..))).))))))..))))))).)))))............(((((((((((((....(((((((((((...)))))))))))........(((((((((..((((.((((.(((((.((((((((..(((...(((.(((((..((((.((.((((((.(((.............((((((.((((.((.((.(((........((((..((((((((..(((......))).....((((.(((((......((((((.......((((..(((((((((.((((((........)))))))).)))))))..))))....))))))(((((((((((((.(((((.((((...)))).)))).).)..))))))).....((((((((((((...............)))))..))))))).))))).....((((.(((.((.((..((..(((.((..((....))..)).)))..))..))))))).)))))))))))))))))))))..))))........))).)).))))))..))))))...)))))))))))))))..)))......(((..(((((((((.((((((............)))))))))....))).)))..)))(((((.....((((((((............))))))))...(((((((.(((.(((((...((..((((...............)))).)))))))))).)))))))((((...))))))))).((((((((((((..............((((.......................)))).....((((..(((((.((....)).))))).)))).))))))))))))..........................)).)))..)))..)))))))))))).).))))......((((......)))).......((((((((....))))))))...((((((.((((((((((((...(((..(((.(((((((((.((((((....)))).)).))))))).)))))...)))..))..((.((((((...((((....)))).....)))))).))...))))))))))...).)))))))))....)))))))))....((((((.((......)).))))))((((......))))..))))..))))))))))))))).))))))))))....(((((.....(((....))).......))))).......)))).)))......
Thermodynamic Ensemble Prediction
......((({{({......,.))))))..(((.((((.,{((({(({{..,|,|},}}.((((((((((.((((((,.(((((((((.....))))))))).}.......,,{{{{{{,,,,..,(((((((({.((((.{....}.)))),,(((((....}))))...........)))))))).,(((((......)))))....(((((((((((((((((((((.(((.((((((((((.(((((,{{,....((((((.((((.((((...)))).)))).))))))....{{.{{,,,....,,|}.|||{|,..((((.((((((.(((((((.....)))),,)).))))))))))...(((.(((((((((....))).)))))).))),.,.|{{{{.,,...}}.,,|,,}|}....,))}....}}})))))...)))))).))))...))))))){(((((((((((((....)))))....)))}.,})))),...........}))))))(((....)))......)))))))))).,||||{.,,,)})),...(((((...(((.((((..{{{((((((...)))))).{((.{{(.{((({,.,....{{|||..|,}.},))),.})).})))))..))))))).)))))............((((((((({(((....(((((((((((...))))))))))).....,..(((((((((..((((.((({.(((((.((((((((,.(({.{|{{{.{,..,.{(((({((.,...}}}.|}}}},...,{{{{{{{{,{{.,,,..,,.{({(,,..}}}{((((....))))|{||.||{({.....,},..,|{{,{{{{{{((,,,{{{((((((.......((((..(((((((((.((((((........)))))))).)))))))..)))),...)))),|((((.((((,(({{(((((,((({...,|||,||||.,,|..}}|||}}.,,,,{(((({,{{{,,{{(.{({{{(,{{{,,,,,,}}}),)),.,))))).}}}.,,||,,||||||{{,,{{,,{{{,{{,.{{,,{{{{,,|,.,,,..||,|}}}|||}..|||}}||||||}|,|||}||||},||{|.....||||{||,,({(((({,{{{{{{{,{{{,,,|||||}}}}{{{||,....}||}}.,,{{{(({|.{{{{{,.,|},,,,.,,,}}}}}}}}}}},}))).,,,,,}}}||||||,{{.,{{{{{{{.|},.,,,},}.}}})}}}},.,{({((((,{{,.{{{{(,,,,,..,,||},........{{|{.,||,,||||||,,||.}|||}}|{{||.,,})))))))..,),))))))}}}..}}}}||,,,,..}))},..,}},})),}))})..})}}}.....{{,,((({..(((({.({....)).))))).)))).,,,))})}})))))),..,}},.......,,,,,..,.}},)))}.)))..)))))))))))).).}))}......((((......)))).......((((((((....))))))))...((((({,((((((((((((...(((..{(,{({(((((((.((((((....)))).)).))))))).)})}}...)))..))..((.(((((({.{(({{....,}|}}}...)))))).))...)))))))))}...).)))))))))....)))))))))..}.((((((.((......)).)))))),{{{......}}}}..)))),.))))))))))))))).))))))))))...,(((,,.....|||,...)))...}}}}))),,.......)))).)))......

Transcripts

ID Sequence Length GC content
ACUCCCGGCUUCCAACCGCGCGGAGCCUCUGCCUUGGAGAUUCUCAGUG… 1911 nt 0.4537
Summary

Arginase catalyzes the hydrolysis of arginine to ornithine and urea. At least two isoforms of mammalian arginase exists (types I and II) which differ in their tissue distribution, subcellular localization, immunologic crossreactivity and physiologic function. The type II isoform encoded by this gene, is located in the mitochondria and expressed in extra-hepatic tissues, especially kidney. The physiologic role of this isoform is poorly understood; it is thought to play a role in nitric oxide and polyamine metabolism. Transcript variants of the type II gene resulting from the use of alternative polyadenylation sites have been described. [provided by RefSeq, Jul 2008]

Forensic Context

A study in porcine skin exposed to bromine vapor demonstrated that the ARG2 transcript was significantly increased at 6 hours, 48 hours, and 7 days post-exposure for both 7- and 17-minute exposure durations, with fold changes ranging from 4.366 to 9.5, and it was involved in significantly altered signaling pathways including IL-10, IL-17, Hepatic Fibrosis/Stellate Cell Activation, and Glucocorticoid Receptor Signaling [Price et al. DOI:10.3109/15569527.2010.546003]. Another study in porcine skin exposed to thermal burn injury showed that the ARG2 transcript was significantly increased at 7 days post-exposure [Price et al. DOI:10.080/15569520903097754].