Basic Information

Symbol
MYOD1
RNA class
mRNA
Alias
Myogenic Differentiation 1 BHLHc1 MYOD Myoblast Determination Protein 1 Myogenic Factor 3 MYF3 PUM Class C Basic Helix-Loop-Helix Protein 1 Myf-3 MYODRIF CMYO17 CMYP17 BHLHC1
Location (GRCh38)
Forensic tag(s)
Wound age identification

MANE select

Transcript ID
NM_002478.5
Sequence length
1803.0 nt
GC content
0.6556

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-795.00 kcal/mol
Thermodynamic ensemble
Free energy: -822.04 kcal/mol
Frequency: 0.0000
Diversity: 313.37
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(.((((.(((.((((.(((((((.((((((((.................((((((((...((.(((((((.((.(((((.(.((.((.((((..((((......((((...)))).(((((..(((((((.(((((((((((((.(((.......))).)))))))))))))...(((((....((..((((((((((....)))..)).)))))..))....)))))...)))))).)..))))).))))..)))))).)).)))))).)).))))))).))...((((.((.(......).))..))))...........)))).)))).(((.(((((.......(((..((((((((.......)))))))).))).......))))))))..............)))))))))).....)))))))))(((((((........)))))))(((((((..((((((.((((.((((((....))))))...))))))))))..))))))).(((((...........(((((..(((.(((.((......)).))))))..))))).(((((((((........((.(((.((((((...)))))).))).))....(.(((((((......).)))))).)..((((((((...(((((.(((((..((((..(.((..(((((((..((.((.((((.(((.(((((..((...))..)))))))).(((((((((........((((((((((((......(((((((((((.((.((...((.(((.((....)).)))))...)).))))))(((.(((((.....)))).).)))......)))))))....))))).))))))))))))..))))......(((((((.(......)))))))))))))).)))))))))..))..)..)))).)))))(((..((.(((.....))).))..)))....)))))))))))))..((((((((((((...(((((.(((((.(((((.((.(((((.((..((((....))).)..)).))))))))))))((((.(((((((.(..(.((((((.(.(.((....(((.(((((...((((((((((....))))))).)))....................((((((..((((((..(((((....))))).((.((((((.....((((...)))))))))).)).(((....)))............)))))).......(((((...)))))(((((....))))).((.(.((((((((........)))))))))))((((....)))).........(((.((......)).)))))))))..)).))).)))....)).).).)))))))..).))))))).))))...(((((((((((.........)))))))))))((((((((((((((....((((((...))))))((((.........)))).((((......))))......))))))))))))))(((((.(..(((((((((..(((..(((.(((....................))).))).....)))..)))))............((((((((...(.......)...))))))))((((((...))))))))))..))))))..(((((...((((((.(((((........))))).))))))....)))))........))))).))))).)))))))).)))))))))))))............)))))..))).)))).).
Thermodynamic Ensemble Prediction
.(,((((.,{{.((((.(((((((.((((((((.................((((((((...((,(((((((.((.(((((.(.((.((.((((..((((......((({...}))).(((((..(((((((.(((((((((((((.(((.......))).)))))))))))))...(((((....((..(((((((({(,...}))..)).)))))..))....)))))...)))))).)..))))).))))..)))))).)).}))))).)).))))))}.}}{{.{(((.((.(......).))..))))}}..,..,},,)))).)))).((,{(((((.....,.(((..((((((({.......}))))))).))).......))))))))....,,........)))))))))).....)))))))))(((((((........)))))))(((((((..((((((.((((.((((((....))))))...))))))))))..))))))).(((((...........(((((..(({{(((.((......)).))))))..))))).(((((((((........((.(((.((((((...)))))).))).)}....{.(((((((......}.)))))).,..((((((((...(((((.(((((..((((..{.((..(((((((.((((...((((((((.(((((..((...))..)))))))},))))).)))},,....(((((((((((((......(((((((,(({{((.((...{{.(((.((....)).)))}}...)).)))))|(((.(((((.....)))).).)))}.....)))))))....))))).)))))))),}}},..|||{.....(((((((.(......)))))))).)))}....)))))))..))..}..)))).)))))(((,,{{.(((.....))).}),.))).,..)))))))))))))..((((((((((((...(((((.(((((.(((((.((.(((((,({.,{(((....}}),,,,)}.)))))}))))))((((.(((((((.(..(.((((((,(,,.{,....({{.{{((..,.((((((((((....))))))).)))........,|,|......,.||{{({||({((((..(({((,...}}}}}.((.(((((({,...,(({...}))))))))).)).,....,..,,..|,,.....,,}}}|}},,.....(((({...}))))(((((....))))).||.|.(((((({{.......,))))))))}))((((....)))).,{{.....(((.((......)).)))}}}}}),,},,))).)}}....}}.}.},)))))))..).))))))).))))...(((((((((((.,.....,.))))))))))){((((((((({(((,...((((((...))))))((((.........)))).((((......))))......)))))))))))))}(((((.(..(((((((((.....,..{,.((({...........}}}}...,||{.|.....,)))}..))))),,.....,,...((((((((...,.......)...))))))))((((({...})))))))))..)))))),,,((((...((((((.(((((.,....,.))))).))))))....))))},.......))))).))))).)))))))).)))))))))))))............)))))..}}).)))).),

Transcripts

ID Sequence Length GC content
AGGGGUGAGGAAGCCCUGGGGCGCUGCCGCCGCUUUCCUUAACCACAAA… 1803 nt 0.6556
Summary

This gene encodes a nuclear protein that belongs to the basic helix-loop-helix family of transcription factors and the myogenic factors subfamily. It regulates muscle cell differentiation by inducing cell cycle arrest, a prerequisite for myogenic initiation. The protein is also involved in muscle regeneration. It activates its own transcription which may stabilize commitment to myogenesis. [provided by RefSeq, Jul 2008] CIViC Summary for MYOD1 Gene

Forensic Context

A study in rats demonstrated that the MYOD1 is upregulated in a time-dependent manner during skeletal muscle wound healing, with its relative mRNA expression peaking at 3 days post-injury (>2.59). Specific expression thresholds were correlated with wound age, where a relative MYOD1 protein quantity >1.33 suggests a wound age of 3 to 7 days, and a relative mRNA expression >2.02 suggests a wound age of 1 to 7 days post-injury [Tian et al. DOI:10.1007/s00414-015-1251-x].