| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGGGGUGAGGAAGCCCUGGGGCGCUGCCGCCGCUUUCCUUAACCACAAA… | 1803 nt | 0.6556 |
This gene encodes a nuclear protein that belongs to the basic helix-loop-helix family of transcription factors and the myogenic factors subfamily. It regulates muscle cell differentiation by inducing cell cycle arrest, a prerequisite for myogenic initiation. The protein is also involved in muscle regeneration. It activates its own transcription which may stabilize commitment to myogenesis. [provided by RefSeq, Jul 2008] CIViC Summary for MYOD1 Gene
A study in rats demonstrated that the MYOD1 is upregulated in a time-dependent manner during skeletal muscle wound healing, with its relative mRNA expression peaking at 3 days post-injury (>2.59). Specific expression thresholds were correlated with wound age, where a relative MYOD1 protein quantity >1.33 suggests a wound age of 3 to 7 days, and a relative mRNA expression >2.02 suggests a wound age of 1 to 7 days post-injury [Tian et al. DOI:10.1007/s00414-015-1251-x].