| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGGCUGCUGGAGCUUGGGGGCUGGUGGCAGGAACAAGCCUUUUCCGACC… | 1507 nt | 0.5773 |
Myogenin is a muscle-specific transcription factor that can induce myogenesis in a variety of cell types in tissue culture. It is a member of a large family of proteins related by sequence homology, the helix-loop-helix (HLH) proteins. It is essential for the development of functional skeletal muscle. [provided by RefSeq, Jul 2008]
A study in human prostate tissue demonstrated that the MYOG mRNA was upregulated in samples with a late ischemic time (>1000 minutes) compared to an early ischemic time (<150 minutes) in an independent validation cohort from the GTEx database, supporting the enrichment of muscle development processes as a function of postmortem interval [Javan et al. DOI:10.1038/s41598-025-29561-7].