Basic Information

Symbol
MYOM2
RNA class
mRNA
Alias
Myomesin 2 165 KDa Connectin-Associated Protein 165 KDa Titin-Associated Protein Myomesin (M-Protein) 2, 165kDa Myomesin Family Member 2 Myomesin-2 M-Protein Titin-Associated Protein, 165 KD Myomesin (M-Protein) 2 (165kD) M-Band Protein TTNAP
Location (GRCh38)
Forensic tag(s)
Individual identification Cause of death analysis

MANE select

Transcript ID
NM_003970.4
Sequence length
5008.0 nt
GC content
0.5337

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1822.00 kcal/mol
Thermodynamic ensemble
Free energy: -1907.13 kcal/mol
Frequency: 0.0000
Diversity: 1591.31
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((((.(((.(((((...))))).))).)...)))))))))(((((....(((.(..(((((((.((((..(((.(((((....(((.(((((((((((..(((((((...(((((((((((.(((((((......))))((((((((..(((((...))))).))))...(((.((((.(((((..((((((...........))))))...))))).))))..))))))).....))).)))....))))))))..((((((....((((.(.((...((.(((.((((.((.(((.(((((..((((......))))..)))..........)).))).)).))))))).))...)).)))))...)).)))).))))))).....))))..(((((...)))))(((((.((.((.(((((..(((((....)))))))))).)))).))))).....))))))))).)....)))))))))))))))))))..).)))))))).........(((....(((((.....((((((((((((((((.(((...((((((..(((((((....((((..(((((.....(((((.(((((((((((....((((((((((((((((((((.............))))(((.((((((((.........(((((((((((((((....))))..((((....))))..((((.((((((.(((..(((.((((((((((...((.((.((((((((((.(((((((((((((..((..(((((....)))))..))((((((..........))))))(((((((.(((((..((((....))))......).)))).)))))))..(((((((((..(....)..)))))).)))..)))))))((((..(((.((((((((((((.(.((.(((((.....(((((.((.(((((.(((((.............((((((.((((((.....(((((..(((......))).)))))....(((...))).)))))).)))))).....(((((((((((.(((((.((.(((....)))..)).))))).))))......((((((.((((......))))))))))(((((.((((....)))).)))))...)))))))....))))).))))))).)))))........))))))).)..))))))..((((((...(((((((..((((((((((((((.....)))))(((..(..((((((((((.(((..(((.(((.((((.((...(.((.(((.(((..(((((.(((.((((...)))).)))((((((.((....((((((((((.(((((......)))))((((((.(((((........(((((..........(.((((((.........)))))).)......)))))......((((((..((((.....(.(.(((.(((((((((......(((((.((((.((((...(((((((((((((..(((((....))))).))))))).....((((((((((((((((((..((((((.((((.....((.(((....))).))......((.(.(((((.((((..(((....))))))))))))).))..((((((..((((...(((.(((((.((((......((..((((((.......(((.((((((((((((((.......)))))...(((((((((((((.((((.(((((.....))))).))))))(((((...(((((((((...........))).....))))))....))))).....((((((.(((((((..(((.....((((..(....)..))))..)))..))))...)))))))))((((((((((((.....((.(((((((((...(((((.......))))).)).)))))))))))).))).)))))))))))))))))(((((...(((((..((....))..)))))...)))))........))).)))))).)))))))))..))....)))).)).)))))).))))))))))))))))))))((((.((((.((((.((((....(....)....)))).)))))))).))))......(((((((........)))))))..)))))).)))).(((((((((((((........))))))).....))).))).....)))))))).)))))))))).)))).(((((((....)))))))..)))))......))))).))))..))).).))))).))))))..)))))))))))))))))))))...(((((...))))).......(((((.........))))).........((((...((((......))))..))))...((((..........)))))).))))))(((((..(((..((((...))))........))).)))))..)))))..))).))))).).((((..((((.((..((((...((((((...((((..(((((..((....))..))))).))))...)))))).))))..)).)))))))).)).)))).)))...)))..)))..))))))))))..)..)))(..(..(((((.(((..((....))..)))...)))))..)..).((((((.(.((((.(((((((((......((((..(..((.(((((.(((((.((((((...((((......)))).))))))..(((((((...(((.(((((((.........(((((((((....)))....))))))((((((((((((........(((.(((((.(((...........)))))))).)))........)))).........))))))))))))))).)))..))).))))...(((((..(((.((((......((((...))))....)))).))))))))(((((.......))))).(((((.....))))).(((((((((...((.(((......(((((.....(((((..(((((..(((((((.....)))))))))))))))))...((((.((.(((((.(((((((.((((((((........)).))))))...........((((((.......(((((...(((((((.(..(....)..).))))))).))))).)))))).))))))).))))))).))))..(((((((((((((((((.....................(((((....)))))..(((......((((........)))).....))).)))))))).......)))))))))..((((.....))))((((((((((..(((...(((.(.((((((....(((.....)))(((.((((((((.((((((.(...(((((......)))))....).)))))).)))))))).))).........))))))).)))......)))))))))))))((((((((((((..(((((((.(((((......))))).))))....((((((((....))))))))............(((((((((.(((.((((.((((((..((((((.....))))))((((((((....(((..(((((((((((.((..(((.(((((.(((.((((((........((....))........)))))).)))...)))))..)))..))))))...)))..))))....)))..)))..)))))..........((((((((((.........((((((((((....(((((((.(((((((((((.(((...........))).)))..)))))))).....))))))))))))))))).........((((.(....))))).....))))))))))))))))..))))))).)))))).)))((((((((.......((.(((((((((....))).))))))))(((((...((((((........))))))...)))))(((((.........)))))..)))))))).....(((((((....(((((....))))).(((((((((...(((((.........))))).))))))))).....((((((.((((((((((((.(((((.(((..((((((....))))))..))).))).))))).))).))))))))))))(((.((....)).))).(((((....)))))...........)).)))))((((.((((.((((.....)))).)).)).)))).)))..))))))).)))))(((.((......)))))..)))))..))).))....)))))))))..............)))))))))).))..)..).)))...))))))))).(((((....)))))((((.....))))((......))))))))))))).(((((((.....((((((((((((((((((.....)))))))..))).((((.........)))))).)))))).......)))))))..))))))))))))))))((((((((...)))))))))))))))))))).))).)))))))))).))).))))))).)).))..))))))))))........((((....)))).........(((((((((...(..((((((....))))))..).)))).......(((((....))))).)))))..)))))).)))))).)))).((((.((((.....)))).))))........)))))))))))))))...)))).))).)))))))).))).((((((((((..((.....)).)))).))))))......))))))))))))....)))).))))).....)))))..))))....)))))))...)))))).))))))).)))))))))))).)))))...)))....................
Thermodynamic Ensemble Prediction
{((((((((,,(((.(((((...))))).))}.},..))))))))}(((((({..(((.{,,(((((((.{{{{,{(({((((({.,,,({({(((((((,,({..{((((((.,{(({{(((((((.(((((((......)))){({{((((..(((((...))))).))))...(((.((((.(((((..((((((...........))))))...))))).))))..)))})},.....))).)))}},,}})))}||,{(((({,,..,(((,{(.((...((.(((.((((.((.(((.((({(.,((((......))))..}),.....}}}.})).))).)).))))))).)).,.}).))))),,,)),}}}}|}}}}}},,,,,,|{{{{.{{{{{..,)))||(((((.((.((.(((((..(((((....)))))))))).)))).))))).,},.))}}}|}},,|,,..}}})))}}}))))))))}},||.,},,|||||,.......(((.{{{{(((({,{{{,((((((,,{(((((({{({{{,{,{,(({{(((((((.(({(((,.{,(((({(({{{{{{({((((({((((({{..(((({{{(({{,{|||,{,|,.,,{{{.{,...|||(((,,((({({({..{{....|||{{|||{||||,||}}.,}},}..}}}{(((((......)))))},})}}}}}.})}}}||,,{(((((..,((,({{({,{(((((({(,{,{,,.((((.,(((..(({((({{,(((((((..((((((,,.....,,.))))))(((((((.(((({..((((....))))......}.)))).)))))))({(..(((((((({{.{({,.((..,|{.((((.((((.{,....})))).)))).)).})})))}.}},,,,...|{{{(((,(({,,,(((((((..({((((((.(((((..(((.((((((...((((((((((.({(((((((((||{{..(((((((,...})))).))).|)}((((.{((((((.(,(({(((,(.,(,((({...|||{{||{|||||{||||,....,((({{{.((((,,,{{{}||||||}||((((,,(((((({,,.|((((({,.({..,,,))..}}))))).,)}))))})},.,..(((((((((((.(({...((((((({((((({,,.,((({{..,,{|||,..}|)}}.,.}))))}}{{|{|({,{,|||{||{.((((((({..,,.{(((({...}}}.)}}.}..}}..}|||||.,{{,(||..,}))})})))..))))))).......{(((.((,(((((......))))).}}}.))))}}))))))...})))).........{({(({(({{({{,....}}||||{{{{....|||}|,...,||||||....||||||||}.,}})}},}}}}|.,....{((((({{,(((({(((..{(((,{,,(((((((..(((((....))))).)))))))....}))))))}|}.}|||{{||((((,.,.}))}}.}}}}||,|}}}}}))))|||{{....{{.,.,,{{(,{{{.{{(((....|))}))})))},,((((.,......))))}})})}}||||||}||||}.|}}}|..}}|}}}}....}}))))))}||,.||.|||,|,...}}})))}}}))))),,),))||}}|((((.(((((.....))))).)))),{(((((.,.((((((({{.,.........})},...}))))))....))))),....((((((.((((({{..((({{,..({({..{....}..))))..}}}..))}},}}}))))))))((((((((,(......,({.{{{.,|}}}.,,|.})))))})}})),.))))))))).)))))))}.)))))))).)).)))..))))))))))).||,..))))))}((((((((.(((((((.((..(((.......))).)).))))))).))))))))..,,,.,))})))))}))))))))...))){(((((((.((({{((((.((((....(....)....)))).)))))))).)))))..))}(((((((........))))))).)))))}}.|||}..||||,||{{|||(,{(....})))))}},,.....}}}}}}},..{((((.....))))),,,,||,,,(((((((....))))))).,})}},.}},.,}))),||||||,|,|,.({{{.{{}}}}})}.))}},,|...{|||{{((((({{{(,,,....}))))}}}}}}}}))}...|,|||,...})))}.......((((...((((......))))..))))...,|||....}}|,..|||||},|((|{((((((..(((..((({...))))........))).)))))),,,,))))),)}))}))))))))),.,)))),,,,,.}}.}}}}||||}}}((((..(((((..((....))..))))).)))),|{,||,,|}})})}.).)))))})||.,,,})))})|)}}}}|||}}|}},}}},,,,}}},.,}})}|||||,.|||||}||||}{,...,)).,)},,}})})))}}}}}},}}||}}}}}|{||,||||||{|,.,,.,.|,}}..|..||}||||..,,,,..(((((,..}||||...,,.||||{|,||}},{(,((((({{{(({.((((((({,{{{....,|}||((({...}))}}......{{{((((((((((((.,,.....(((.(((({{(((........,..)))))))).)))........)))}.,.......,))))))))))||||{||,..|||,,||,...||||,,,|{,}||||},....((((...)))){{{{||||{,||||,,|(((((.......|,,||.{{({{,,,{.||||,.(((((((((,..(({(((......,,,||}}}}.(((((..(((((,.{((((((.....)))))))))))))))))...((((.(,,(((((.(((((((.((((((((........)).))))))...........((((((.......(((((...(((((((.{..(....}..}.))))))).))))).)))))).))))))).))))))).))))..{((((((((((((((((....,,.........,,.,|.(((((....)))))..(((......((((........)))).....))).)))))))).......))))))))).{((((.....))))}(((((((((..(((...{((.(.{{{{{{....(((.....))}.,,.((((((((.((((((.{...(((((......)))))....).)))))).)))))))),||{{...,{{{.,,,)))),}}}},,,,.})))))))))))|(((({((((((({.(((((((.(((((......))))).))))....((((((((....))))))))............(((((((((.{(,{((((.((((((..{(((((.....)))))}((((((((......(((((((((..((...},.)))))).)))|,.{(((((({{.{{.{{((,{{{||.....{{{((,..)})))...,,,,,...,.}})..,.)},)))).)).))},..}))}})))}.,))))..........((((((((((.........((((((((((....(((((((.(((((((((((,(((,,....,.}..)}}.)))..)))))))).....})))))))))))))))).........((({,(....))))).....))))))))))))))))..)))))}).)))))).)))((((((((....{{{((.(((((((((....))).)))))),{(((((...((((((........)))))}...)))))|,{{{.........)))))..))))))))...{{{{{{((({{,.(((((,,,,|}}}}.(((((((((...(((({.......,.))))).))))))))).....{{(((,{((((((((((((.(((((.(((..((((((....))))))..))).))).))))),})).))))))))))}}||||{{....||{||,.{{{{{.,..}||||,||......}}})))).},((((.((((.((((.....)))).))},).)))).)))}}))))))),|}}}}|||,||,,,,,,))),)}.}}}}},,})},))}}},))))))))).,,........,,.}))))))))).|)},}..}.}}.,{.},,,,))},.(((((....)))))((((.....)))),,.,.,{{||||}||||||,..((((,(({{,.,((((({(((({(((((((.....))))))),.||,.((((,,{{,{{,.}|}}}}.}|)))),,.,,..|}|}}||{|,||||{|,,|||||,.((((((({...}))))))),,}))))))),.,,,})}))))))}}),))},}}}|||}{||{|,{,,,||||,,,,.......}|}}.}}))))}.}},......{{(((((((...({,((({((....))))))}.,.)))).......(((((....))))).)))))..,)}}))})))}}..,,,,,((((.((((.....)))).)))).......,},))))})))))},|.}})))},))).})))),}},}}}.((((((((((..((.....)).)))),,))))).,.,...)))))))))}},}}})),,})))))}))}})),))}}))))..}))))))))}}}))),))})))}))|||||||}}}}}}},|||||..,))),,......}}}},.......

Transcripts

ID Sequence Length GC content
AGGGAGGCACAGGCGCUUGCUUUGCAGGAGUCAGCUCUGCCUUCCUCGG… 5008 nt 0.5337
Summary

The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD and 165 kD. The predicted MYOM2 protein contains 1,465 amino acids. Like MYOM1, MYOM2 has a unique N-terminal domain followed by 12 repeat domains with strong homology to either fibronectin type III or immunoglobulin C2 domains. Protein sequence comparisons suggested that the MYOM2 protein and bovine M protein are identical. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human thoracopagus conjoined twins found the MYOM2 was expressed at low levels with a hypermethylated promoter in one twin, associated with early growth and cell death/survival pathways [Chen et al. DOI:10.1016/j.rbmo.2023.03.001]. In a separate human study of sepsis, the MYOM2 was identified as a differentially expressed mRNA that was downregulated in patients with sepsis compared to healthy controls [Qin et al. DOI:10.1097/JCMA.0000000000000209].