Basic Information

Symbol
MYOZ1
RNA class
mRNA
Alias
Myozenin 1 Calsarcin-2 FATZ CS-2 MYOZ Filamin-, Actinin- And Telethonin-Binding Protein Myozenin-1 Protein FATZ Myozenin
Location (GRCh38)
10:73631571-73642103
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Tissue/body fluid identification
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_021245.4
Sequence length
1300.0 nt
GC content
0.5346

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-480.00 kcal/mol
Thermodynamic ensemble
Free energy: -500.35 kcal/mol
Frequency: 0.0000
Diversity: 284.26
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((((..(.....)..))))))))......((((.(((((..(((((((((.....((((((((..(((((((.((...(((((((((..(((.((((((.........((...((....(((((((.(((((((......(((.(((........)))))).(((((((......))))))).....)))))))((((....))))....)))))))....))....)).........)))))).))).)))..........))))))..)).)))))))..........((((((((...((((((((((......))).(((...((((.....))))..)))((((((((....))))))))((((((....))))))))))))).))))))))..((....))..(.((....)).)))))).)))...)))))))))(((((((((......((((((......((.(.((((((((.(((((.(((.....))).))))).)))))))).).))))))))..)))))))))......((((((...))))))(((((((((((..((((((.((((....((..((((((((((((.((((((....)))))).............((((((((((.(((.(((.((((((....))))))(((...((((........))))....)))((((((...))))))......................(((((.....))))))))..)))))))))).)))...((((((((((......((((..........))))........((((.((((...((((...)))).)))).))))........................)))))))))).........(((((((((((.(((((.((((.((((((((.(((..(........)..))).))).)))))...((((.(((..((((((((....(((....))))))))))).))).)))).....((((((((((.......))))))))))......))))...)))))...((((......))))........)))))))).))).....((((((......)))))).)))))..))))..)))))..))))..).)))))..)))))))))))..)))))))))....((((.(((....)))..((((((((((((((...(((((........)))))...)).)))))).((((((((((((....)))).)))).)))).......))))))........)))).
Thermodynamic Ensemble Prediction
.((((((((..{.....}..))))))))......{(((.(((((..(((((((((...,.((((((((..(((((((.((...(((((((((..(((.((((((....,,...((...((,...(((((((.(((((((......(((.(((........)))))).(((((((......))))))).....)))))))((((....))))....)))))))....)).,..))..},,....)))))).))).}))..........))))))..)).)))))))....,.....((((((((...((((((((((......))),(((...((((.....))))..)))((((((((....))))))))((((((....))))))))))))).))))))))..((....))..(,((...,}).}))))).)))...))))))))){((((({{{.,.,..((((((......((.(.((((((((.{((((.(((.....))).))))).)))))))).).)))))))).,))))))))),..,.,((((((...))))))(((((((((((..(((((,.((((..(((.((((.(((,.(((..((((((....))))))..........,,.((((((((((.(((.(((.((((((....)))))}{{{...{{((.......,}}}}....}}}((((((...)))))}..|,..................(((((.....))))))))..)))))))))).))).,}{(((((((((.,,,,,((((..........))))....|}}}|(((.((((..{({....,).)..)))).)))}........................)))))))))},,....,}.,,))}.))))))).))).,}}},((((((((.(((..(........)..))).))).)))))..(((((((,.{{(((,((,({{{,((((.....})}))}}||,{{{((,({{.{{,((((((((({.......})))))))))}}.,.}))))))))))},|}|.|}}}}..}})}..,}}}....||||,|||{|}|,....((((((......)))))).}}})),.))))}..))))..}}}}..,.)))))..)))))))))))..))))))))),,..{{{{|(((,...}}}..{{{{{{{{{||||||.,{((({||,.....}}},....}}.}}}}}}.((((((((((((....)))).))))))}))..,,,,.)))))),,...,),})}).

Transcripts

ID Sequence Length GC content
NM_021245.4 NCBI
ACAGCAGCUCAGUCCUCCAAAGCUGCUGGACCCCAGGGAGAGCUGACCA… 1300 nt 0.5346
Summary

The protein encoded by this gene is primarily expressed in the skeletal muscle, and belongs to the myozenin family. Members of this family function as calcineurin-interacting proteins that help tether calcineurin to the sarcomere of cardiac and skeletal muscle. They play an important role in modulation of calcineurin signaling. [provided by RefSeq, Apr 2012]

Forensic Context

A study in humans identified the MYOZ1 as a highly specific and sensitive mRNA biomarker for the identification of vaginal secretions, demonstrating no cross-reactivity with other body fluids at 5 ng input and only minor cross-reactivity with saliva at higher inputs, while successfully detecting vaginal secretions in mock casework samples [Hanson et al. DOI:10.1016/j.scijus.2012.03.007]. A subsequent multicentric study in humans, utilizing a 19-plex mRNA profiling assay, confirmed the MYOZ1 as a vaginal mucosa marker but found it to be consistently less sensitive compared to other markers like MUC4 and CYP2B7P1, with a lower percentage of peaks above the analytical threshold and a lower average relative contribution to the total vaginal signal in both pre- and postmenopausal women [Chierto et al. DOI:10.3390/cimb45080411]. A study in humans demonstrated that the MYOZ1 is a highly specific and sensitive mRNA marker for identifying vaginal secretions, showing no detection in skin surface swabs and only minor cross-reactivity with saliva at high input levels, with expression levels 4-5 fold lower in saliva than in vaginal secretions [Hanson et al. DOI: 10.1016/j.scijus.2012.03.007]. In a separate human study investigating transfer and persistence, the MYOZ1 was identified as a promising and more specific vaginal mucosa marker, showing better performance and a higher degree of co-expression with other vaginal markers compared to MUC4 [Johannessen et al. DOI: 10.1016/j.fsigen.2022.102750].