Basic Information

Symbol
MYOZ2
RNA class
mRNA
Alias
Myozenin 2 FATZ-2 C4orf5 CS-1 FATZ-Related Protein 2 Calsarcin-1 Myozenin-2 Calcineurin-Binding Protein Calsarcin-1 Chromosome 4 Open Reading Frame 5 Muscle-Specific Protein CMH16
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Sudden unexpected death diagnosis

MANE select

Transcript ID
NM_016599.5
Sequence length
2549.0 nt
GC content
0.3488

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-575.50 kcal/mol
Thermodynamic ensemble
Free energy: -630.45 kcal/mol
Frequency: 0.0000
Diversity: 693.86
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......((.((((((.(((.((((((((......)))))(((.((((((.....(((((((....((((((.((((((((..((((.(((((..(.((((((.((......((((....)))).(((.....)))..........((((.((...........)).)))).(((((((....)))).))).((..........))..((....)).....)).)))))).)..)))).((((((((..(((.((((((((........)))))..)))..)))..))))))))).)))).......(((((((((((((((.(((((.....(((......(((((((((.........))))...........((........))))))).......)))........))))).))..)))..)).)).))))))..)))))))).....))))))..))))))).((.....))..))))))..)))....((((..(((.(((..((((((((.....(((.((...((((((((((((....)))))........((((......))))..................((((((((....................))).)).)))....))))))).)).)))......)).))))))...(((((((((((((...((....))..(((((....)))))....(((((((.((((((.((((((...........(((((..((((.......((((((.(((..............)))..))))))(((((.((((((..(((((......((((((((((((((......((.....)).....((((((.....))))))(((((((.((((((((......)))))..(((((((.((.((.(.(......).).)).)).))))))).((((((..(((((.......((((((((((((((((...)))).((((((((((((...(((((((((((((((((............((((......)))).........))))))....)))))))))))(((((.........(((((.(((.......))).))))).......(((((.....)))))..........................))))).((((((((..........(((((..((((..((...((.((.((((.((((((((........))).)))))........(((((........)))))((((((.....(((((((......)))))))....)))))).)))).)).))..))..))))..))))))))))))).))))))))))))...(((((.((.((((((((((.((((((((((..(((...((((((((((((.((.(((.((.(((.....((((((((.....((((..(((..((.((.((((((.....)))))))).))...)))...))))(((((((...)))))))((((......)))).)))))))).....))).)).))).)).)))))))....)))))...)))..)))).)))))).......((((.....))))....(((((((....)).)))))....))))))))))....((....)))).)))))((((((((((((((((((..((((((...))))))((((((....(((((((.(((....(((((......)))))))).)))))))....))))))....................))))))))..................)))))))))).))))))))))))......)))))..))))))......((((((......))))))...))).)))))))............))))))))))))))...)))))..)))))))))))((((((..........))))))..(((((((.................)))))))((((((((((((((((((...............))).))))))).)))))))).............))))..))))).....)))))).)))))).)))))))(((((...(((((.(..((((.......))))..).)))))...))))).)).)))))))))))...........)))))).))))...........((((((.((.((.(((((((....((((..........))))..))))))))).)).))))))..............((((.((((((((.((((((((((((((...)))))).....((((((((((.....((((.....(((((((....((((.......))))...)))))))......))))))))))))))((((((((....))))))))..)))))))))))))))).))))..)))))).)))))).))...(((..(((.((..(((((...)))))..)).)))..))).((((((.((((((((..((((((...)))))))))))))).).)))))............
Thermodynamic Ensemble Prediction
.(((((.(.((((,..}}}}.|.|||}}..,{{((,(((((((({,.{{......,||..,.||.,,..{(((((((,(,.{({(((.((((..(.((((((,({.....,{|{,....||||.((({....}},.........}|||,.||},.........}}.|||{.(((((((....)))).)))}}}}.........||..{{....)).....}}.)))))).)..)))).}})|)|,|))))))}}}}|}|))}},....||||}|{|||,.}||,,|||||||||||||{.,.....{{{(((((,{(({,{,{(({{..,.||{|||,..,||||{{((,..,....},}}}},,,,....,}}||....,|||,,}}}}|,.{{{{{|}}.....,,,|,,||,||{{|||{{{|{|}|.}|||,..|(((|{{{..{{...||{{,{((,{({{.,..,,.,}},.}))}}}}))),.}}}},,},}}|..|||,,,{(({{{(,.,,.(((.((...((((((((((({....}))))}.....,.((((...,,,)}}|({,...,)),........((((((((....................))),}),,))....,)))))).)).)))..,|,.,)}))))}|,..((((((((((({{...,{|,,,||..(((((....))))).,{{{((((((,((((((.(({{{{....,,,{,,{(((((,,((({..,,.,.{{{{{|,|||,.....,,,,},}}))},,}}}}|}(((((.((((((..(((((......((((((((((((((....,.((.....}}.....{(((((.....)))))|(((((((.((({{{{{......,}},},.{{{{(({.{,.{,........,,|,|.||.,,.))))))).((((((..(((((..{{.{.(((((((((((({(((...}))),((((((((((((...(((((((((((((((((..........,,(({,.,,,,.}})}.........))))))....)))))))))))(((((.........(((((.(((.......))).))))).......(((((.....)))))..........................))))).((((((((.........,{((((,.((((..((...((.((.((({.,(((((({.{{{{.{{{{..{{||,..,,....(((((........))))),{{{,,,..,}}|,||{|..,..}),)),))}},,,}))))))))).)).))..))..))))},)))}})))))))).)))))))))))),,((((((.{{.((((((((((...(((((((.,.,,{{{,((((((((((((.((.(((.((.{{{.....((((((((,.,,{((({..,....{{.{{{((((({,...})))))))).)),,.,||{....}}|((((((...))))))|((((......))))||}}}}))}.....}}}.)).))).)).)))))))....}}}}}.,,|||..,....,}|||}|,,..,.{(((.....))))|||,||||)||....,)))))))..,.)))))))))).....|,..,)))}.}}}}}|((((((((({{(({,,(,,((((((...))))))((((((....(((((((.(((...{((({{...,,,)}}}}))).)))))))....))))))...,.,,,,,,,,......,)))))))}}....,},....,,....}))))))))},)))))))))))).}}}..)))))..))))))......((((((......))))))...))).)))))))}...........))))))))))))))...)))))..))))))))))).|,.,|,|,,.{({{(((((,,.}}}|}}}|,}..................{{{{((((((((((((((((((...,,.....}....))).))))))).))))))))})}.....,,},.}))}..)))}}.,,,,)}}))).)}}}}|.}}}}}}||{|{(..,((({{.{..((({.......))))..}.}}))}...))))),}}.})))))))))).}},},.....}}}))}}))))}}}}}}.....((((((.((.(,{(((((((....((((..........))))..))))))))).)).)))))},}}}}}}},.....,,||}|||{|||.{(((((({,,..,,,...,,,}}|||||,{{,,,,,,,,.....||,,,,,|,{{{{{{{....{{{,{{{{,..,}))}}}))))))).,|{{{||||||,}}}}}},((((((((....))))))))..,,,})),))))))))),))))},.})))}.,|||{{{{|{,,{,,.,(((,{{..(((({...}))))..)},}}}.,}}},||||||.{{{|||{|,,||||||...,}}}},,}}}}}}}...}||||{.....}}})).

Transcripts

ID Sequence Length GC content
AGUCCCCAGUUUGAGUCAGAGUAGGGACCAUGCUGUCCCAGGUUCAAGG… 2549 nt 0.3488
Summary

The protein encoded by this gene belongs to a family of sarcomeric proteins that bind to calcineurin, a phosphatase involved in calcium-dependent signal transduction in diverse cell types. These family members tether calcineurin to alpha-actinin at the z-line of the sarcomere of cardiac and skeletal muscle cells, and thus they are important for calcineurin signaling. Mutations in this gene cause cardiomyopathy familial hypertrophic type 16, a hereditary heart disorder. [provided by RefSeq, Aug 2011]

Forensic Context

A study in mice demonstrated that the MYOZ2 is associated with chromatin immunoprecipitation clusters enriched in down-regulated long non-coding RNAs following myocardial infarction [Ounzain et al. DOI:10.1093/eurheartj/ehu180]. In human forensic research, the MYOZ2 was listed among differentially expressed cardiac-related genes in sudden unexplained death cases, with mutations reported in ion channelopathies or cardiomyopathies [Neubauer et al. DOI:10.1007/S00414-025-03414-4].