| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACACACACAUCUGCACCUCAACCACAGACUACACUUGCUGAACUGGCUC… | 925 nt | 0.5838 |
Involved in positive regulation of cell population proliferation. Located in cytoplasm and extracellular region. [provided by Alliance of Genome Resources, Jul 2025]
A study in human patients with severe erectile dysfunction demonstrated that the MZB1 is expressed in B cells within penile cavernous tissue, as identified through single-cell RNA sequencing analysis [Fang et al. DOI:10.3389/fendo.2022.874915]. A meta-analysis in humans identified a network of 33 validated interacting proteins and their regulatory miRNAs linking post-mild traumatic brain injury signaling in peripheral fluids with neurodegeneration-associated pathways, where the MZB1 was mentioned as a neuroprotective protein that reduces beta-amyloid precursor protein-immunopositive axons [Matyasova et al. DOI:10.4149/gpb_2021038].