Basic Information

Symbol
MZB1
RNA class
mRNA
Alias
Marginal Zone B And B1 Cell Specific Protein MEDA-7 PACAP PERp1 HSPC190 Plasma Cell-Induced Resident Endoplasmic Reticulum Protein Mesenteric Oestrogen-Dependent Adipose Gene- 7 Marginal Zone B- And B1-Cell-Specific Protein Mesenteric Estrogen-Dependent Adipose 7 Plasma Cell-Induced Resident ER Protein Proapoptotic Caspase Adaptor Protein Proapoptotic Caspase Adapter Protein Plasma Cell-Induced ER Protein 1 MGC29506 Marginal Zone B And B1 Cell-Specific Protein Caspase-2 Binding Protein MEDA7
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Other applications

MANE select

Transcript ID
NM_016459.4
Sequence length
925.0 nt
GC content
0.5838

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-358.00 kcal/mol
Thermodynamic ensemble
Free energy: -376.00 kcal/mol
Frequency: 0.0000
Diversity: 278.91
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((.(((((.(((.....((((..((((((((..(((((..((((((.((((((..((.((((((..((.(((..((.((....)).))))).))((((((....))))))((((((.(....).)))).))....)))))).))))))))((..(((....((((........))))..)))..))..((((((.((.((((((....(((.(((((((.((.(((.((((((........))))))..))).)).))....................))))).)))))))))..)).))))))..(((((((((.(((((((((((..((((..(((....)))..))))))))))......)))))....)))))))))((((......)))).(((((.............))))).))))))....)))))))).))))).(..((((..(((((....)))))..))))..)..(((((((((((....((((((((((((......)))))....(((..((((((....((((.((((((....(((((((.(((....((((((......(((((((.(.((((((.((((.(((((......(((.(((....((((...)))).....))).))).......))))).)))).)))))))))))))).))))))...)))(((((((((((((((.....))))))...))).))))))....)))))))))))))..))))((((.(.....).))))))))))..)))....))))))).................(((((...((((((..(((((.......))))).....)))))))))))))))))))))))))).....))).)))))....))))............................
Thermodynamic Ensemble Prediction
..,{{{{,,.{(((((((({.((((({....{.((((((({...{(.((((((({({.((((((,.((((((((({,{((.(((((({{.(({((((((((((....)))))},((((({,{{..|{||||{|{.,....(((((((((.(({....}))....((((........)))}.,.,|,,|{{.,((||,...|||{,}}}..)}..)))).)))))))))..((((((.,......))))))....||,.|(({{{,,.{{|....{||{,..,}}),))}}}||||,}.,)))).}}}}}}||||||,{.{||,|||||||..||,|}}|||}}}})))..,})))))|||,....,)))),,,.,)))),)},))))).,.))))))..)})))))))))))))))).(((....)))..((.,,.}}((((.((((((.(((((((.,,||}|,.((((((((((((((...,(....}}...)))}))))))))))).,.,{.|{{{,....(((..((((((..,.{((({(((({(,,..(((((({.{((...,((((((......(((((((.{.((((((.{(((.(((((....{(((,{(((.{{{(,,,.}}))))}}...})},))).......))))).)))}.))))))}))))))).}))))}...)))(((((((((((((((.....)))))}..,))).))))))....))))))))))))),.|||}|||}}}.,...)})))}))))))..))}......,,,.,))})).}}}........))).))))))))))..{{{{,....,.}}}}))}),))))))...)))).)))))|{(((((((,....,)))))))),...))))............................

Transcripts

ID Sequence Length GC content
ACACACACAUCUGCACCUCAACCACAGACUACACUUGCUGAACUGGCUC… 925 nt 0.5838
Summary

Involved in positive regulation of cell population proliferation. Located in cytoplasm and extracellular region. [provided by Alliance of Genome Resources, Jul 2025]

Forensic Context

A study in human patients with severe erectile dysfunction demonstrated that the MZB1 is expressed in B cells within penile cavernous tissue, as identified through single-cell RNA sequencing analysis [Fang et al. DOI:10.3389/fendo.2022.874915]. A meta-analysis in humans identified a network of 33 validated interacting proteins and their regulatory miRNAs linking post-mild traumatic brain injury signaling in peripheral fluids with neurodegeneration-associated pathways, where the MZB1 was mentioned as a neuroprotective protein that reduces beta-amyloid precursor protein-immunopositive axons [Matyasova et al. DOI:10.4149/gpb_2021038].