Basic Information

Symbol
NCF1
RNA class
mRNA
Alias
Neutrophil Cytosolic Factor 1 SH3PXD1A NOXO2 P47phox NCF1A 47 KDa Autosomal Chronic Granulomatous Disease Protein SH3 And PX Domain-Containing Protein 1A Neutrophil NADPH Oxidase Factor 1 47 KDa Neutrophil Oxidase Factor Neutrophil Cytosol Factor 1 NADPH Oxidase Organizer 2 Nox-Organizing Protein 2 Nox Organizer 2 P47-Phox NCF-47K NCF-1 Neutrophil Cytosolic Factor 1 (47kD, Chronic Granulomatous Disease, Autosomal 1) Neutrophil Cytosolic Factor 1, (Chronic Granulomatous Disease, Autosomal 1) Chronic Granulomatous Disease, Autosomal 1 CGD1
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_000265.7
Sequence length
1349.0 nt
GC content
0.6227

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-516.90 kcal/mol
Thermodynamic ensemble
Free energy: -541.41 kcal/mol
Frequency: 0.0000
Diversity: 279.45
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((...(((((((.((((....)))))).(((((((.((((.(((((.(..((((((((...((((......))))..))))).)))..).))))).(((.((.((((.(.....).)))))).))))))))))))))((((..(((.......))))))).................((((((.((.........)).))))))..((((.(((..((((........)))).))))))).)))))..)))..((.(((.....(((((((..((((.((..(((((((((((((((..((((..((((..........)))).))))..)))))...........(((((.(((.(..(((..((((.((.(((.((....)).))).)).......(((((((((..(..((.((((.........(((.(((.((((..((((..((.((((((..(...((((....((.((..(((..........)))..)).))..)))))..)))))).))..(((.....)))))))..))))))).)))))))...)).)..))))).))))))))..)))..).).)).))))).)))))))))).((((......((...))((.(((((...))))).))(((((((((((.(((.(((((((((..((((.(((..((((((...(((..(((((((((((.(((...............))).))).)))).))))..)))....))).))).))))))).)))....)))))).)))..........((((((((..(((((((((((.....(((..((((((....((((.(((...........))))))).........(((((.....)))))..(((.....))).......((((((.(...).))))))..))))))..))).....((.....))))))))).((((((.(((..((((((..((..((.((....((((.((..(((.(......).)))..)).)))))))))).))))))..))).))))))..))))))))))))..))))))))))).(((((((((((((((((((.....((((((((((.((((.....)))..).)))))...(((...)))...)))))....))))).((....))..))).)))))))))))))))((((((.(((((((.....))).)))).))))))...)).))))..)))))))...))).)).......(((((..(((.(((((((..(.((((......).)))))))))))))))))))...((((((.((((....))))...)).)))).
Thermodynamic Ensemble Prediction
.{.(((((,(,...|||}}}.{{{((((((((((((.((((.(((((.(..((((((((...((((......)))}.,)))))},))..}.))))).{((.(.{((((.{.....}.)))))}.))))))))))))){((({..(((.{...,.)))})))}...,.{,,.......,||,,,...,....})))}))}).((((..((((.(((..((((........)))).))))))).))))(({,(({{{(((({{{{{{({((({,{{((((.((,,(((((((((((((((..((((..((((..........)))).))))..)))))...........(((((.(({,(..(((..(((({(({{(,,((,...,},}}}.}|||....,{(((((,,({,(..,,.,..........{((((.(((.((((..((((..((.((((((..(...((((....((.((..(((..........)))..)).))..))))},.)))))).))..(((.....)))))))..))))))).)))))))}..})})},)}))).))))))))..)))..).).)).))))).)))))))))).{({{......{{...}}((.(((((...))))).))(((((((((((.(((.(((((((((..((((.(((..(((((({..(((..(((((((((((.(((...............))).))).)))).))))..)))..}.))).))),)}))))).)))....)))))).)))..........((((((((..(((((((((((.....(((..((((((.{...,((,,.,....{(({..{({.(((({....}.))))})}.)))),},,...(((.....))).......((((((.{...}.)))))),.))))))..))),,...{{.....))))))))).((((((.(((..((((((..{{..((.((,...((((.((..(((.|......,.)))..)).))))}))))).))))))..))).))))))..))))))))))))..))))))))))).(((((((((((((((((({....,(({({{(((({(({,...,,|}|.,.})))))...{{,...,}}.|||||}}.||.}}})).{{..,,))..))),}))))))))))))}}{((((({{{({{((,....|||.||}|{||||||{..|},|||}.,}||||||,.,...,.,,,.,}},|{|||.}|||.{{||{{|}}|,||||,}}...),)..},}))))))))))),)}})),,}}}}}||.....,,}))))))))))).

Transcripts

ID Sequence Length GC content
AGCACUGGAGGCCACCCAGUCAUGGGGGACACCUUCAUCCGUCACAUCG… 1349 nt 0.6227
Summary

The protein encoded by this gene is a 47 kDa cytosolic subunit of neutrophil NADPH oxidase. This oxidase is a multicomponent enzyme that is activated to produce superoxide anion. Mutations in this gene have been associated with chronic granulomatous disease. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the NCF1 transcript, a marker for inflammatory response, was upregulated 3.1-fold in the injured ipsilateral neocortex three days after mild traumatic brain injury [Israelsson et al. DOI:10.1089/neu.2008.0676]. In human circulating leukocytes, major blunt trauma triggered a selective upregulation of the NCF1 transcript, and its expression level was significantly correlated with the Max Denver 2 clinical trauma score [Brandfellner et al. DOI:10.1097/SHK.0b013e31829de02f]. A study in mice demonstrated that p47phox-deficient animals suffer from impaired dermal wound healing due to compromised endogenous hydrogen peroxide generation, which was completely corrected by topical low-dose H2O2 treatment, accelerating wound closure and improving angiogenesis [Roy et al. DOI:10.016/j.ymthe.2005.07.684].