| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCACUGGAGGCCACCCAGUCAUGGGGGACACCUUCAUCCGUCACAUCG… | 1349 nt | 0.6227 |
The protein encoded by this gene is a 47 kDa cytosolic subunit of neutrophil NADPH oxidase. This oxidase is a multicomponent enzyme that is activated to produce superoxide anion. Mutations in this gene have been associated with chronic granulomatous disease. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the NCF1 transcript, a marker for inflammatory response, was upregulated 3.1-fold in the injured ipsilateral neocortex three days after mild traumatic brain injury [Israelsson et al. DOI:10.1089/neu.2008.0676]. In human circulating leukocytes, major blunt trauma triggered a selective upregulation of the NCF1 transcript, and its expression level was significantly correlated with the Max Denver 2 clinical trauma score [Brandfellner et al. DOI:10.1097/SHK.0b013e31829de02f]. A study in mice demonstrated that p47phox-deficient animals suffer from impaired dermal wound healing due to compromised endogenous hydrogen peroxide generation, which was completely corrected by topical low-dose H2O2 treatment, accelerating wound closure and improving angiogenesis [Roy et al. DOI:10.016/j.ymthe.2005.07.684].