| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCUUGCUGGGAAGAGAGGCGAAGCCAGGUCACCUUUCAAGGACCCAGAA… | 421 nt | 0.4513 |
The human NDUFA1 gene codes for an essential component of complex I of the respiratory chain, which transfers electrons from NADH to ubiquinone. It has been noted that the N-terminal hydrophobic domain has the potential to be folded into an alpha-helix spanning the inner mitochondrial membrane with a C-terminal hydrophilic domain interacting with globular subunits of complex I. The highly conserved two-domain structure suggests that this feature is critical for the protein function and might act as an anchor for the NADH:ubiquinone oxidoreductase complex at the inner mitochondrial membrane. However, the NDUFA1 peptide is one of about 31 components of the "hydrophobic protein" (HP) fraction of complex I which is involved in proton translocation. Thus the NDUFA1 peptide may also participate in that function. [provided by RefSeq, Jul 2008]
A study in humans identified the NDUFA1 as one of the top ten most central mitochondrial genes via protein-protein interaction network analysis in sepsis patients [Li et al. DOI:10.1186/s12920-024-01891-x].