Basic Information

Symbol
NDUFA1
RNA class
mRNA
Alias
NADH:Ubiquinone Oxidoreductase Subunit A1 CI-MWFE MWFE NADH Dehydrogenase (Ubiquinone) 1 Alpha Subcomplex, 1, 7.5kDa NADH Dehydrogenase [Ubiquinone] 1 Alpha Subcomplex Subunit 1 NADH-Ubiquinone Oxidoreductase MWFE Subunit NADH:Ubiquinone Oxidoreductase (Complex 1) Complex I MWFE Subunit Type I Dehydrogenase NADH Dehydrogenase (Ubiquinone) 1 Alpha Subcomplex, 1 (7.5kD, MWFE) Complex I-MWFE MC1DN12 ZNF183
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_004541.4
Sequence length
421.0 nt
GC content
0.4513

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-120.50 kcal/mol
Thermodynamic ensemble
Free energy: -127.99 kcal/mol
Frequency: 0.0000
Diversity: 93.85
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....(((((..((((((.((.......)).)))))).....))))).(((((((...(((((..((((((((..((((((((((.((.....((.(((.((((((((((((..(((((.((((..(((..((..(((.........))).)))))..)))).)))))...))))((((((...........)))))).....((......))))))))))..))))).....)).)))))))))).......))))))))..........(((((.......(((((((((.((((.....)))))))))))))........)))))......))))).....))))))).............((((((((((((((.....))))))))))))))........................
Thermodynamic Ensemble Prediction
..,..(((((..((((((.((.......)).)))))).....))))).(((((((,..(((((..((((((((..((((((((((.{{.....{{|{{{,((((((((((((..(((((.((((..((({..,.{(((...,.,,..,,)},.}))..)))).))))).,.})))((((((...........))))))....,}|,,,,,.})))))))))..))),...},,}),))))))))))....,..}}}}}))}.,,.,,||,.{{{{{,,.....((((((((,{((((,...,)))))))))))))......,,||}}}.,,}},)))))...,.)))))))....,.,,.....((((((((((((((.....))))))))))))))........................

Transcripts

ID Sequence Length GC content
GCUUGCUGGGAAGAGAGGCGAAGCCAGGUCACCUUUCAAGGACCCAGAA… 421 nt 0.4513
Summary

The human NDUFA1 gene codes for an essential component of complex I of the respiratory chain, which transfers electrons from NADH to ubiquinone. It has been noted that the N-terminal hydrophobic domain has the potential to be folded into an alpha-helix spanning the inner mitochondrial membrane with a C-terminal hydrophilic domain interacting with globular subunits of complex I. The highly conserved two-domain structure suggests that this feature is critical for the protein function and might act as an anchor for the NADH:ubiquinone oxidoreductase complex at the inner mitochondrial membrane. However, the NDUFA1 peptide is one of about 31 components of the "hydrophobic protein" (HP) fraction of complex I which is involved in proton translocation. Thus the NDUFA1 peptide may also participate in that function. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans identified the NDUFA1 as one of the top ten most central mitochondrial genes via protein-protein interaction network analysis in sepsis patients [Li et al. DOI:10.1186/s12920-024-01891-x].