Basic Information

Symbol
NDUFA13
RNA class
mRNA
Alias
NADH:Ubiquinone Oxidoreductase Subunit A13 GRIM-19 GRIM19 CGI-39 CDA016 B16.6 Gene Associated With Retinoic And Interferon-Induced Mortality 19 Protein Gene Associated With Retinoic And IFN-Induced Mortality 19 Protein NADH Dehydrogenase [Ubiquinone] 1 Alpha Subcomplex Subunit 13 NADH Dehydrogenase (Ubiquinone) 1 Alpha Subcomplex, 13 NADH-Ubiquinone Oxidoreductase B16.6 Subunit Cell Death Regulatory Protein GRIM-19 Complex I B16.6 Subunit Complex I-B16.6 CI-B16.6 Cell Death-Regulatory Protein GRIM19 MC1DN28
Location (GRCh38)
Forensic tag(s)
Chronological age estimation

MANE select

Transcript ID
NM_015965.7
Sequence length
521.0 nt
GC content
0.6161

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-207.00 kcal/mol
Thermodynamic ensemble
Free energy: -214.98 kcal/mol
Frequency: 0.0000
Diversity: 94.48
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((...(((((((((((((((.(((..(((((..(((.....)))....((((((((((...(((((.((..((((((...........(((.(((((((.((((..(((((........)))))))))(((((((....)))))))..(((((((..(((....((..((((((((((((.....(((.(((......(((((.((((..((.(((..((((.((((.((....)).)))))).))...))))).)))).)))))......(((((((....))))))).)))..)))....)))))..((((.(.(((.(((....))).))).)))))..))))))).))....))).))))))).))))))))))((((((((...(((((.(((....((((....))))...)))))))))))))))).))))))....)).)))))...))))))))))))))).))).)).)))((((((....)))).)).....)))))).)))).)))..
Thermodynamic Ensemble Prediction
(((...(((((((((((((((.(((..(((((..{,{{{...,,}.},,((((((((((...(((((.,,,{((((((..{{{......|||.(((((((.((({..((((({,....}.)))))}}))(((((((....)))))))..(((((((..(((....{{..((((((((((((..,..(((.(((.,...{({(((.((((,,((,(((,,{{((.((((,((....}}.}}}))),),...)))}},)})).}}})),.,,.}||||{{{.,..)))}))}.)))..)))..,.)))))..((((.(.(((.(((....))).))).}))))..))))))).},....))).))))))).))))))))))((((((((...(((((.(((....((((....))))...)))))))))))))))).))))))...,),.)))))...))))))))))))))).))).,)})))((((((....)))).)).....)))))).)))).)))..

Transcripts

ID Sequence Length GC content
GGGAUACUGCGAGUAUGGCGGCGUCAAAGGUGAAGCAGGACAUGCCUCC… 521 nt 0.6161
Summary

This gene encodes a subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I), which functions in the transfer of electrons from NADH to the respiratory chain. The protein is required for complex I assembly and electron transfer activity. The protein binds the signal transducers and activators of transcription 3 (STAT3) transcription factor, and can function as a tumor suppressor. The human protein purified from mitochondria migrates at approximately 16 kDa. Transcripts originating from an upstream promoter and capable of expressing a protein with a longer N-terminus have been found, but their biological validity has not been determined. [provided by RefSeq, Oct 2009]

Forensic Context

A review of human studies identified the NDUFA13 as a gene associated with epigenetic aging clocks, being part of a top list of genes linked to 11 such clocks [Solovev et al. DOI:10.1016/j.mad.2019.111192].