| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGGAUACUGCGAGUAUGGCGGCGUCAAAGGUGAAGCAGGACAUGCCUCC… | 521 nt | 0.6161 |
This gene encodes a subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I), which functions in the transfer of electrons from NADH to the respiratory chain. The protein is required for complex I assembly and electron transfer activity. The protein binds the signal transducers and activators of transcription 3 (STAT3) transcription factor, and can function as a tumor suppressor. The human protein purified from mitochondria migrates at approximately 16 kDa. Transcripts originating from an upstream promoter and capable of expressing a protein with a longer N-terminus have been found, but their biological validity has not been determined. [provided by RefSeq, Oct 2009]
A review of human studies identified the NDUFA13 as a gene associated with epigenetic aging clocks, being part of a top list of genes linked to 11 such clocks [Solovev et al. DOI:10.1016/j.mad.2019.111192].