| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCACUUGGCCUGAAGACCUGGAAUUGGCGACUUCGAUAUUAACAAGGAU… | 614 nt | 0.5065 | |
| GCACUUGGCCUGAAGACCUGGAAUUGGCGACUUCGAUAUUAACAAGGAU… | 649 nt | 0.5162 |
The encoded protein is a subunit of the hydrophobic protein fraction of the NADH:ubiquinone oxidoreductase (complex 1), the first enzyme complex in the electron transport chain located in the inner mitochondrial membrane, and may be involved in regulating complex I activity or its assembly via assistance in redox processes. Mutations in this gene are associated with Leigh syndrome, an early-onset progressive neurodegenerative disorder. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
A study in humans identified the NDUFA2 as one of the top ten most central mitochondrial-associated genes via protein-protein interaction network analysis during the investigation of sepsis biomarkers [Li et al. DOI:10.1186/s12920-024-01891-x]. A study in mice demonstrated that the NDUFA2 gene was upregulated in common in both blood and spleen leukocytes at 2 hours post-injury across three distinct models of systemic inflammation: trauma/hemorrhage, burn injury, and lipopolysaccharide infusion [Brownstein et al. DOI:10.1152/physiolgenomics.00213.2005]. This upregulation was identified through microarray analysis and is part of a common early transcriptional immune response, with the majority of such commonly altered genes being assignable to immune response and cell death pathways.