| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUAUCGCGGACGGAAGAUGGCGUCCGCCACCCGUCUCAUCCAGCGGCU… | 580 nt | 0.5517 |
This gene encodes a subunit of NADH:ubiquinone oxidoreductase (complex I), which is a multiprotein complex located in the inner mitochondrial membrane. Complex I functions in the transfer of electrons from NADH to the respiratory chain. [provided by RefSeq, Mar 2011]
A study in mice demonstrated that NDUFA7, a hub gene related to mitochondrial oxidative respiration, was transcriptionally up-regulated in the ventral tegmental area during the addicting phase of nicotine self-administration, indicating its role in the associated mitochondrial dysfunction and energy metabolism alterations [Fan et al. DOI:10.1016/J.Jgg.2024.08.009].