| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUGCGCAGGCGCCGUGUGGCACUCGGCGGUCGAAAGGGGAGUUCAAGGA… | 804 nt | 0.5062 |
The protein encoded by this gene belongs to the complex I 19 kDa subunit family. Mammalian complex I is composed of 45 different subunits. This protein has NADH dehydrogenase activity and oxidoreductase activity. It plays an important role in transfering electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
A study in mice demonstrated that exertional heat stroke induces a sustained epigenetic memory in the left ventricular myocardium lasting over 30 days of recovery, characterized by genome-wide DNA methylation reprogramming including hypermethylation in the promoter region of the NDUFA8 gene, though this epigenetic change did not predict corresponding mRNA expression levels at rest [Murray et al. DOI:10.1152/physiolgenomics.00147.2021].