Basic Information

Symbol
NDUFA8
RNA class
mRNA
Alias
NADH:Ubiquinone Oxidoreductase Subunit A8 PGIV NADH Dehydrogenase (Ubiquinone) 1 Alpha Subcomplex, 8, 19kDa NADH Dehydrogenase [Ubiquinone] 1 Alpha Subcomplex Subunit 8 NADH-Ubiquinone Oxidoreductase 19 KDa Subunit Complex I-19kD Complex I-PGIV CI-PGIV MGC793 NADH Dehydrogenase (Ubiquinone) 1 Alpha Subcomplex, 8 (19kD, PGIV) NADH:Ubiquinone Oxidoreductase PGIV Subunit Complex I PGIV Subunit CI-19KD MC1DN37 CI-19kD
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_014222.3
Sequence length
804.0 nt
GC content
0.5062

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-259.20 kcal/mol
Thermodynamic ensemble
Free energy: -275.40 kcal/mol
Frequency: 0.0000
Diversity: 199.47
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....(((((.(((((((.((.((((....((................))..)))).)).)))))))...((((((.(((((..(((((..((((.(((...(((((((((....((((.(((((....((((((((((.(.((((((.((..(.(((...((((((.((((.(.(((.((((((.(((..(((((..((.....))..)))))..)))))....(((((....)))))((((((.(((.........)))..)))))))))).))).).))))))))))))).)..)).)))))).).))))))))))((((((....((((..((((((..((..(........)..))..))))))))))))).))).((((((.....(((((((.((((((.....)).)))).....)))))))....)))))).......(((((((((.((((.((..((((((...(((..(((((((......((....)).....)))))))..)))....)))).........))..)).).))).).))))))))..(((((......)))))((.((.(((((....))))))).))..........(((((...........)))))))))))))).))))).)))).)))))).)..)))))))))).)).))))...(((((......)))))((((.(((..((..(((((.(((((....(((((......)))))....)))))))))).)).))).)))).......)))))((.(((((...))))).))...
Thermodynamic Ensemble Prediction
..,.{((((,(((((((.((.((({,,..((,,..,,,,..|||..,},,.)})).)).))))))),..{({|||,||{{{,{(((((,,(((({({({{.{,{((({((...,((((.{{{{{}},}|(((((((((,(.((((((.((..,.(({..,((((((.((((.{.(((.((((((.(((..(((((..((,....)}..)))))..))))}....(((((....)))))((((((.(((.........))).,)))))))))).))).}.))))))))))))}.)..)).)))))),).))))))))),((((((....((((..((((((.,((..{........}..)).,))))))))))}}).))).((((((...,.((((((({((((((.....)).)))}..}..}))))))....)))))).,...},{||||||{|,|||}||||}||{{((.,,({{||(((((((......((....}}.....)))))},.,|||,{{{|}||,,|||.|,..,..,.,|,|||,|,|}}}}}}},,{{{{{...,,.)))))((.({{(((((....))))))).)).......,..(((((..,,.....}.)))))|||}}}}}},)}}))|)}}|,}}}}}}.)..}))))))}}}.|,.}}}}.,|||||}},}}},}}.})||||.|,|,,||..||||{.(((((....(((((......)))))....)))))))))),)),},}.))},.......))))}{{.{{{{,...,}}}}.)),..

Transcripts

ID Sequence Length GC content
AUGCGCAGGCGCCGUGUGGCACUCGGCGGUCGAAAGGGGAGUUCAAGGA… 804 nt 0.5062
Summary

The protein encoded by this gene belongs to the complex I 19 kDa subunit family. Mammalian complex I is composed of 45 different subunits. This protein has NADH dehydrogenase activity and oxidoreductase activity. It plays an important role in transfering electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Forensic Context

A study in mice demonstrated that exertional heat stroke induces a sustained epigenetic memory in the left ventricular myocardium lasting over 30 days of recovery, characterized by genome-wide DNA methylation reprogramming including hypermethylation in the promoter region of the NDUFA8 gene, though this epigenetic change did not predict corresponding mRNA expression levels at rest [Murray et al. DOI:10.1152/physiolgenomics.00147.2021].