Basic Information

Symbol
ARHGAP35
RNA class
mRNA
Alias
Rho GTPase Activating Protein 35 GRF-1 P190A P190ARhoGAP P190RhoGAP KIAA1722 GRLF1 Glucocorticoid Receptor DNA-Binding Factor 1 Glucocorticoid Receptor Repression Factor 1 Rho GTPase-Activating Protein 35 Rho GAP P190A P190-A Glucocorticoid Receptor DNA Binding Factor 1 P190ARHOGAP GRF1
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_004491.5
Sequence length
9290.0 nt
GC content
0.5277

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-3422.20 kcal/mol
Thermodynamic ensemble
Free energy: -3580.76 kcal/mol
Frequency: 0.0000
Diversity: 2436.36
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((....((.(..((.(((((.(.((.((.(((((.(.(((.(((((((((.((.....((..((((((((((...(((((.(((((((((..(((((((((.((((.(((((((((....)))).....(((((..(((....(((((((((((..((..(((((((((((((.(((((...(((.((((((........))).))).)))....))))).))))).....))))))))..))((((((...(((((((...)))).)))....(((..(((((.((((..(((.((((((......................)))))).))).)))).)))))..)))...((((..((((....))))))))....(((((((((.....)))).)))))((((...((......))....)))).....((((((((((.......))).))))))).....((((.((((((((((.(((((.((.(((.((((.(((.(((((((((((.((....))...((((((....(((((((.((((...))))((((.........)))))))))))..(((...((((((((((((((((((....))))))))((((((...((((((..........))))))))))))...(((....((((((.((...(((((((((............((((..((.(((((((.......(((((((((((.(.(((((((((...(((((((((((((((.(((((......))))).)))))......((((.....((((((.....(((((....))))).))))))...))))..(((((....(((((.(((....)))))))).....))))).))))))))))....))).)))))).).))........))))))))).......)))))))))..))))))))))))))).))))))...))).......((((((((((((..((((((...(((.....(((((..............(((((((.((((((((((((.....))))).......((((((((((((....(((...))).((((.((....))))))((((((((((.((((....))))........(((....)))((((((.((......)).))))))((((((..(((....)))..)))))).......(((((((..................))))))).((((((.(((((((......)))))))....((((..(((.(((.((........)).)))))).))))....(((((..........)))))....))))))))))))))))(((((((((((.(((.((.((((((((.((((((((((.....))((((......((((((((....(((((....))))).))))))))...))))...................(((((((((((((((..((..............)).)))))....((((........))))..))))))))))))))))))...(((((....(((((((.((.((((...))))..((((((((((..((((..(((.((......)).)))..))))..((((...))))...((((.(((((.(((((.....)))))....(((((((.(((..((.((((((.....))))...........)).))..))).))))))).....((((((......)))))).).))))))))))))).))))).....((((((((.((((...)))))))))))).(((((((...(((((((.(((.((..................(((((((((..(((..((((((((((...)))))))))).)))....)))))))))...((((.(((........)))))))((((((((((((((((((..(((((((((((((......)))))...........(((((((....((((......)))))))))))....))))))))..)))))))))))((((.((((.(((....((.(.((.((....)))))))...))).))))))))..((((((((.(((.....))).)))))))).(((((........))))).(((((...........)))))..............(((((...(((((((..((((((((........))))))))....)))))))...)))))...)))))))...............)).))).))))))).....))))))).((((..((((.(((((((((((((((...((.((((((..((..((((((.((((..(((..........(((((((.(((((((((.(((..((...((.((((.......)))).))...))..)))..))))))...((((((..((..((((((.......((((.........)))).((((((.(((...(((((....))))).))).).)))))..))))))..))..))))))...(((......)))..((((........((((((((((((((((((((...(((((..((((.....((((((.(((.(((((..((((..((((((.........(((((((((((((((((((....)))......((((.....))))...((((.((((...))))))))..)).)))))))))))))))))))).))))...((((((.(((((((.....((....))..)))).))).))))))......((((((((...((((((......(((....(((((......)))))..))).....((((.....))))........))))))...(((((.(((((......))))))))))....(((((((((.((((........)))).((((.((((....(((((...(((((...(((((......((((((((((.....))))...))))))(((((((.....)))((.((((((((.....((((...(((..(((......)))..)))...)))))))))))).)).............(((..((((...(((.(((((((.((((..((((((....((..((..((((.(((.........)))))))....))..))....))))))))))((((((((((((...)))))).))))))........(((((...(((....))).))))).......((((((.(....).)))))).((((.....)))).....))))))))))((.((....))))((((((.........))))))..(((((((.....(((((((((((((.(((((.......((((((((((..(((...(((((((((((...............(((((((((.((.(((((....((((.(((...((((((..((.....))..))))))...(((.........)))......))).))))........))))).))((.(((((......)))))))((.((((.......))))))....))))))))))))))))))))))).)))))))))).......)))))....))))).)))))))).)))))))....))))..))).(((.((((((.(((..((...(((....................)))..))..))).)))))).))))))).................)))))..))))).)))))..))))))))...)))))))))...))))).)))(((((.(((.((((((......))))))....))).)))))))))).)))))))))......)))).))))).))))...)))))...))))))))))).....)))).....)))))))))).(((((((((.(((((((.((.(((..........)))))....(((.(((..(((((.....(((.......((((..(((.....))))))).......)))((((((((......)))))))))))))..)))((............))...)))....)))))))))).))))))...)))...)))))))))).))...((((((((...................)))))))))))))))))))))...)))))))...(((((((...)))))))...))).))))...))))..))..)))))))...))))).))))..............))))..))))).)))))))))))........))))))))))))...(((((((((((((((((((((....)))))(((....)))....)))).)))))))).....)))).((((....))))..((((...)))).((..(((((.((((..(((..(((..((..(........)..))..)))..)))((((..((((((.........)))))).))))....)))).))))).)).)))))))))))))))))))..))).))))))))))..((.(((((((....(((.((.(((.((((...))))...))).)).)))..))))))).))....(((....))))))))))).))))))).))).)))))))))....))))))).....).))).))))))).))).)).))))).)))))).....))))))))))))))....)))))))))))..))).)))))..((((((((((((((((.(((((((.............(((.(((.(....).))).)))...............(((.(((.....((((((((((..(((.((((((((..((((.(....(((.(((((.......(((((((((((((..(....((((.(((.((....)).))).)))).....)..))))))...(((.((((........)))).)))..(((((((((((..((((((..(((......(((((.((((((..((.(((((((((((((.((((((.(((....))).)))))))))(((((((.......)))))))(((((........)).))).....)))).)))))).)).....))).))).)))))..))).)))))).)))))))))))....((.((((((((((((..((((((((((........))))((((((((((......)))))(((......)))......(((((((....))))))).)))))..(((((((...)))))))(((((.(((.......(((((((.((...((....))..)))))))))(((..((((((((((((((((.(((((((..(((.(.((((...))))..).))))))))))...))))(((((((((((((.........(((((((((..((((((..((((((((....((((....((((((.....))))))..))))...)))))...(((((((...................))))))).)))..))))))(((.....((((((((..............))))).)))....))).......(((((............)))))...(((((((...................((.(((((((.((((((..(((((........)))))..))))))..)))))))))(((....)))))))))).........)))).))))))))))))))))))..(((((((.((((..........))))..)))))))....((((..(((((.(((((((((....((((((....))))))..)))))).))).)))))..)))).))))))).)))))..)))))))))))........(((......)))............))))))..))))))))))))))(((((((((....((((.(((((.((((((((((((.((((.(((((((((((((.(((..(((((((..((((....))))((((((((((.((((.((((((...(((((((....))))))).)))).(((((((.((..((....)).)).)))))))(((((...((.(((((.(((.(((((.(((((.(((.....)))((((((((....)))))))).)))))((((......)))))))))..))).)))))))....))))))))))))))))))))).)))))))..))))))))(((.....)))..((((((((.(....((((((((((....((....))....))))))..).)))....).)))))))).(((((....)))))))))))))..)))).)))..((((((((((.((((((((.((......))...)))))))).))))))))))....((((...)))).((((..(((((((.(((((.......((((((((((((((..((((.(((((((((((((((((((......))).((((.(((((((.(.....).)))))))..))))..((((((((((........))))))))))..((((((((((.....(((((........)))))(((((((...(((((.(((...((((.......)))).)))))))).....)))))))..(((((...((((((.(((.((((..((((((....(((((((((((((.((.(((.(((((......))))).)))..)).))))))))).)))).......))))))....)))).))).))))))))))).......((((.((((((.(((...((((((((((((....(((((((.(((((((....((..((.....(((......)))....))...))...))).)))).))))(((((.((((((((((((.((.((.((((((.((.((((((....)))))).....)).))))))...((((....((.((((((.....(((((((......).))).))).....((((((((((..(((..((((((.(....((((......)))))))))))......((((((..(((.(((((((((((.(((.(((....)))...))).))))))).)))).)))......(((((....))))))))))).........(((..(((((((.....))))))).)))))).))))).))))))))))).))....)))).))))))))))..(((((.((...)).)))))....))))))))))).......))))))))))))))).))))))))).))))...(((.....)))))))).))))))))))))((((....))))...(((((((((((((((.(((((((....((((((((((....))))...))))))((((((.((((((((((....(((((...((((....)).))...)))))....))))))).))).)))))).((((((((........(((((.(((((((((.......(((((((((.((((((.((..((((((((.((..((((.(((((((.......)))))..)).))))..))))))))))))))))))))).......)))))).....)))).))))).)))))...))))).)))...)))))))..))).))))))).((((((..(((((((.(((.((((((((.(((((...(((((((.((...((((....)))).)).)))))))))))))).)))...............((((.((((((((((.(((...)))..)))))))).)).))))((((((..((((((....))).))).))))))..))).)).).))))))).....))))))))))).))))))))).)))).))).)))..(((((.....)))))(((((..((((((((......))))))))..)))))..((((((((((..((((...((..(((.((((((....)))))).)))..))))))....)))))))))))))))))).((((((((((..(((((.......)))))...)))))....)))))..))))).))))))).)))).))))))))).))))).)))))))))))))......))))))).....(((((..(((((((........)))))))..)))))((((((((...................(((((....)))))))))))))))))).)))...).)))).))))))))((((......))))..)))..))))))))))...))).))).(((((((((....)))))))))..))))..)))))))))))))))))))...))))).))))...))))))))).))))....)))))))))).))))))))))..))...)).)))..(((((((((((..(((((((.......(.(((((...))))).)(.((((.....)))).)(((((((.((((.....)))).)))))))...(((((...)))))((((((((((.(.......).)))))).))))))))))).)))))))))))..)))))).))).)))))).)).)).).))).)).))..).))...)))...........((((((.....(((.(((((((..(((((((((((((((((((...........(((((((.(((((((.((.((..(((..(((.(((.(((((((.(((((.(((((...((((((.........))))))...)))))))).)).)))........)))).))).)))..)))..)).))))))))))))))))...........((((((((...........))))))))...((((((((((((....((......))...)))))).....(((((.((((.(((((((((((..((....))..)))))))))))..))))..)))))....((((((..((((((....)))))).))))))..........))))))))))))))))..(((((...((((((((((..((.(((.((((((.((((((...((((((.((...)).))))))((((((((.....))))))))......((((((((.....)))))))).((((((......)))))))))))).))).....)))..))).))......)))))))))).)))))...)))).)))))..)))..)))).)))))))))........
Thermodynamic Ensemble Prediction
{({,,{{(({,{,(({{((((,(.((.((.(((((.(.(((.(((((({((,((.{...((..((((((((((...(((({,(((((((((..(((((((((.((((.(((((((((....)))).....(((((.,(({....(((((((((((..((..(((((((((((((.(((((...(((.((((((.,.....,))).))).)))....))))).))))).....))))))))..)){(((((.,,(({{(({.,.})}}.,}}....{{{..(((((.((((,{(((,((((((...,,{.......,.,|,....}}))})}}}}.}}}}.}}}}}..}}}...((((..((((....)))))))).,|.(((((((((.....)))).})))).|,,.,|{{,.....))....,}}},,,..(((((((.((,.,....)))}))))))).,.,,{(((.((((((((((.(((((.((.(((.((((.(((.{(((({((((({((....||...((((((..{.(((((((.({{{...}}}}((((.........)))}})))))),.(((.,,,{{(((((((((((((((....))))))))|{{(((.,,((((((..{....,..)))))))))))}.,{(({{...{{{{{{.||,,,{{(((((((............((((..((.(((((({.......(((((((((((.(.(((((((((.,.((((((((({(((((,(((({...,,,||||,,|||||......,((({((,....|}}}.}}},{{{,...}))))).))))),},,})))}}|{{{(....(((((.(((....))))))))...,,)))))}})))))))))....))).)))))).).))........))))))))).......)))))))))..)))))))))))))},{|||}},...,},...,,,}((((((((,(({{{((((((.,{({(.{{.,(((((((({{,,{{.{{{,.,,||||.||...{((((((.....)))))}.,...(((((.....))))).....,{({((.((({,((....))))))}))}})},}}}))}}}},.))}),,}},.,,,,,...}})}|||({{.{{......|}.}}}}||,,{{{{..({(.,,.}}},.|||,(((((((((.(((....{..(((((((....(((((.(((((((({((.(((((((......))))))).)}.,|((((((...)))))),....(((((((.(((((((........(((((((((((.(((.,..(((..((((({.....,,..(((((((((,((({,{,(((..{{{,((({((,{{{||.....|{||}..||}{,,,||||,...(((((....))))}.,}}|||||...||}}.,,...,,..,,,|,..,.{{{{{{{{{{(((((,,{{......}}.....,))}}})))....((((........))))..))))))))))}}))))}},},|,{{({{{|||.{{||,{{,((({...})))....}}}.....,.{(((..(((.{(......)).)))..))))},{(((...)))},..,{{{.{{{{{.(((((.....)))))....(((((((.{((..((.((((((.....)))),,.........)).))..))).)))))))....{((((((,....{|||||}.|,}||||||}.{{,{.{((((.(({.((((((((.((((...)))))))))))).})).))))}.,.....|||,.....}}}.,,,..........(((((((((..(((..((((((((((...)))))))))).)))....)))))))))...((((.(((........)))))))....,},}..}))))}})).,}}}))}}})})))}}}}}))))))))........(((((((....((((......))))))))))).....}))))).(((((.......)))))....))).....))))))))}..(((.((((((((((....((((((....((((((((.(((.....))).)))))))).(((((.,....,.))))).(((((...........))))),,,,......,,..(((((...{((((((..((((((((.{.....,))))))))....})))))}...)))))((((((...,(((,....((.(({....})).)).....})}...,,,,,)))))),{{{{..},.,,,}..))))|(((((..(((.{,{((.(({....})))))}.))).)))))}(((((....)))))(((((((((((.,.{{((....}}}}.(((.({{...,...,)}}.))}...,.)))).)))))))))))))))))))},)))))).........,))))).(((((,,(((...(((((....))))).))).).)))))......))))))).},)))))).(((......)))............,}))))))..)))}))...)))))))..},.....)))))))))))).|||,|,.(((((((({{(,{..,{{..{{({.{((((((((((((((((((..{.}}}|..,,,|{{{.....))},...((((.((((...))))))))..})}))))))))))))))})),.}}..,....})},.}))))))|,{((((((.{,.(((((({(((.(((((((({{({{,{(((({(,,{((((({{.....,{{{....(((((....,.)))}}..,|,..,{{(({{,.{{{{,.,..{(,,,,||.{{|,.,||||||||||{.|.,,.|}|}))}}|,{{,.{{{{{{{({.{(,,........}}}),{{{||{{((,.,.(((((...(((((,..(((((,{{...((((((((((.....))))...)))))}((({{{(...{{||,((.(((((({{....,{{{{.,,(,,.,{,|,,,,,,)})}.))}},,)}}))))}}}}).))..,.}}..,.,..({{..{{((...(((.(((((((,|{{,..((((((....((..((..((((.{{{.{......,)))))))..,,))..))....))))))}}}|((((((((((({...}))))).)))))),.....,.(((((...(((....))).))))).,.....{(((((.{....}.)))))).((((.....)))).....))))))))))((.({....))))|(((((.........)))))}..(((((((..{{.,((((((((((({.(((((.,.....((((((((((..(((...(((((((((((.{{{....}}}....(((((((((.,{,(((((....((,(,{{(,{,((((((..((.....))..))))))...||,,..,,.,,.,}}.,,,,,}}).})},........|||||,,,{{.{((({......)))))))||.((((.......))))}}..,.))))))))))))))))))))))).)))))))))).....,.)))))....}))))}}})))))),)))))))....))))..}||.(((.((((((.(((..((...(((,{{..........,,,....)))..))..))).)))))).))),))}...........,...,,)))})..})}}}.))))),,))}}}))),}.}))}}}))),,|}}{||||,,{((({.{{{.((((((......))))))....})},)))}},|||,{({.,{...}))),}.}}})},,,,.|||.((((((((((((((((((........)))))).)))))))).))))..(((((((((.(((((((.({.(((..........))))),,..{{,.|||,.(((((.....{((,....,,((((..(((.....))))))).,,....)))((((((((......)))))))).,|||..},}||................,)))}...))))))))))}})))))...(((..{{({(({{{,...||.||||{||||}}}.........,}},},,})}}})))).})},,.)))))}||||,...,,,,|{(((({...))))))),..}}},,.))})))}}}},}}}|||{,{({.(((((((..((((.....((((..(((.(((.((((....))))..))).))).)))).....))))))))))).}||({((({((((,{(((....}))||(((....)))}}}.}}}},}}}})))}||}..}}})}{{{{.,,,||||,.||{,..,}})).|,,,|{{((,((({...},,.},,..,,..,,,}}||}.||{|...}))}.|||({{,..||{|||.,.......}|||||.,,)),,,.)),,}))))),}}})))))))))))),.))}}))}}.}}))}}.,)))),.||.(((((((...,{({.{{.(((.((((...))))...))).}),)))..))))))).))}},.,}},,,})),)))))))).))))))).,)).)))))))))....,})))}}.,...}.,}),),,)))).))).)).))))).)))))),....}))))))))))))}....)))))))))))..))).)))))..((((((((((((((((.((({{((,,...........(((.(((.{....}.))).))).{,.......,..|,(((.({(,,...((((((((((..(((.((((((((..((((......(((.(((((.......(((((((((((((..{....((((.(((.((....}}.})),))))...,.}..))))))...(((.{(({........)))),|||,.(((((((((((..((((((..(((......(((((.((({((,.((.(((((((((((((.((((((.(((....))).)))))))))(((((((.......))))))){{{,(,,.,,...}}.))}.,,..))))}}})))).)),....})).))).)))))..))).)))))).))))))))))),)},((.((((((((((((..((((((..(({{(({,{,||||((({{(((((......|}}}|(({.,{{,.|||.{,{.{(({(((({,..||,}|||,||,||..(((((((...}))))))((((..,,...}}}}.(((((({,({...((....))..)))))))))}}.}}||||,{|{|||{{({{.(((((((..{((|{.{{((,..))))..},))})))))))...)))}||||||{|||{||}|||||...,||||||{|{{{{((((..,|||||||}}}..,||....{((({(,....}}}}||{.|||{,{{,||||.{,((((({(.{{{,{{.......,,,.,||||{{..((({{{({((((,......((((((((....,....,....))))).))}....{||{{.....,||||,...........)))))...{(((({,..,.........,....,.,{.(((((({,(((({(..(((((.{{....,))))),.)))})),,)))))))}}||{....})}}}))))),,,,....(((((...))))),))))))),,)}.||||,,|,.|||||,,,,...,)}).,,},)))))}}.,{|{{.,{{(((.{(({(((({....((((((....))))))..)))))).))).))))),.}))),|}}|))),))),..,||{||||,}}},,....}}}||,,......|,,.....,,...))))))..))))))))))))))(((((((((....((((.(((((.((((((((((((.((((.(((((((((((((.(((..(((((((.,((((....))))((((((((({{((((.((((((,,.(((((((....}|})))},||}}.(((((((.((..((....)).)).)))))))||{((.,,((,{((((.(((.(((((.(((({.(((,...,)))((((((((....)))))))),))))}((((......))))))))),,))).))))))).,..)))))}))))))))))))))).)))))))..)))))))){((,....,,)},((((((((.(....((({((((((....({....})....))))))..).)))....).)))))))).(((((....)))))))))))))..)))).)))..((((((((((.((((((((.((......))...)))))))).)))))))))).......,..,}|{{{((({..{((((((.(((((.......((((((((((((((..((((.((((((((({{{((((((({.{,,.|}|{((((.(((((((,(.,...},||||||}.,||||{,((((((((((.,,...,,)))))))))),{({(((,,(((......|||,.}}}}},((.((((((((((...(((((.(((...({((.......}))}.)))))))).....))))))).))).)){{{((((((.(((.((((..((((((....(((((((((((((.((.(({.(((((......))))).)))}.)).))))))))).)))).......))))))....)))).))).)))))))}{{{{{,....((((.((((((.(((...((((((((((((....(({..,.....,||...((((((((..{{,((((...{({(,....)).}),..))))..}.))..)))))))).((({(((((.((.((.(((((((((..,.(((((((.......((((.((((.((((((((((.{{{,,,{{,||,|,.....{((({....((((((((....))))))))....{{{{{{{(.((,{((((({(....((((......))))))))))))).}}|((.,,|},(((.(((((((((((.(((.(((....)))...))).))))))).)))).)))....,.(((((....)))))))))))}........,||..(((((((.....)))))))}))))),,))))))).))).)))).))))....(((....)))..)))))))..))).)))))).)),),)))))))),.|{{......,))})))))))))))).))))))))).))))...{,|},,.,}||||,||||||||||||,||(((,,{..,,)).}}|||||||||||||{|,||{{{|||..,|(((((((((....))))...))))))||||||.{{||||((((,,,,{{{{{...{{,|,,.,,,.)),,.))))),,,,))|}}}}.}}),)))))),|,|{|||{..,,|,..(((((.(((((((((...,...(((((((({.((((((.({.,((((((((.((,.((((,(((((((.......)))))..)).))))}.))))))))))))))))))))}.....}}))))))....,)))},))))).))))}.,{||||,||},..})))))))..)}||||}}}}|{((,((((,(((((((.(((.((((((((.(((((...(((((((.{(...((((....)))).)).)))))))))))))).)))...............((((.((((((((((.(((...)))..))))))))},).))))((((((..((((((....)}),))).))))))..))).)).}.)))))))}))).))))}.))))).))))))))).)))).))).))),,(,,{,,,,..,}}||(((((..((((((((......))))))))..))))),.((((((((((..(((({..,(..(((.((((((....)))))).)))..})))))....)))))))))))))))))).((((((((((..(((((.......)))))...)))))...,)))))..))))).}))))))}))})}))))))))),)}))),)})))))))))))......)))))))..,.,(((((..(((((((........)))))))..)))))|(((((((.................},|((((....))))})))))))}))))).))}...}.)))).)))))))){{((..,...)))),.)))..))))))))))..,))}.))).(((((((({....})))))))).,)))}..)))))))))))))))))))...))))).))))...))))))))).))))....)))))))))).))))))))))..))...)).)))..(((((((((((..(((((((.......(.(((((...))))).)(.((((.....)))).)(((((((.((((.....)))).)))))))...(((((...)))))((((((((((.(.,....,).)))))).))))))))))).)))))))))))..)))))).))).)))))).)).)),|,||}|((({{{.{({{{{,|||..,{|{{.|||{{{,|{{,..,,,,.{(({,{{{{,{((({...{(({{{{{{{...........{||||||,{{{{{{,.,|}||.}|||},|||}||||||,,....,,{{,}||||{}|,||||{|,,.....,,|}||}|.{{||}},|||{{{{{{|{{{.....}))}.)))})}}}}).,.,)),,}))}}}))})}})}},,,,....,..{(((((((.,.....,}..}))))))).,.{(((((((((((.,..{,......})...)))))).....(((((.(((,.(((((((((((..({....}}..)))))))))))..})})},))))}.,,,{(((((..{(((((....)))))}.}))))}..........))))))})))))))}},}||||,,}}}|||||||||{|||||,..,({({{,{,.,,,}}}||||||,||...}},|||}|{((((((((.....))))))))},.,,,,{{((((((((((((..(((((....(((..(({{{(({...)))))))..))).....))))).)))))))))))}})))}.,||{|{{..,,)})))),........,,,.,,}},,......,,...

Transcripts

ID Sequence Length GC content
GCCCCGAGGGAGAGCCGCGGCGCGGCGGCAGGAGGAGGUGGAGGAGGCG… 9290 nt 0.5277
Summary

The human glucocorticoid receptor DNA binding factor, which associates with the promoter region of the glucocorticoid receptor gene (hGR gene), is a repressor of glucocorticoid receptor transcription. The amino acid sequence deduced from the cDNA sequences show the presence of three sequence motifs characteristic of a zinc finger and one motif suggestive of a leucine zipper in which 1 cysteine is found instead of all leucines. The GRLF1 enhances the homologous down-regulation of wild-type hGR gene expression. Biochemical analysis suggests that GRLF1 interaction is sequence specific and that transcriptional efficacy of GRLF1 is regulated through its interaction with specific sequence motif. The level of expression is regulated by glucocorticoids. [provided by RefSeq, Jul 2008] CIViC Summary for ARHGAP35 Gene

Forensic Context

A study in mice demonstrated that the ARHGAP35 gene was down-regulated across all seven brain regions examined in ethanol-naïve High Drinking in the Dark (HDID-1) mice compared to control mice, with fold changes ranging from -1.45 to -1.85 [Ferguson et al. DOI:10.1007/S12035-018-1252-0].