Basic Information

Symbol
NDUFB7
RNA class
mRNA
Alias
NADH:Ubiquinone Oxidoreductase Subunit B7 CI-B18 NADH-Ubiquinone Oxidoreductase B18 Subunit B18 NADH Dehydrogenase (Ubiquinone) 1 Beta Subcomplex, 7, 18kDa NADH Dehydrogenase [Ubiquinone] 1 Beta Subcomplex Subunit 7 Cell Adhesion Protein SQM1 Complex I B18 Subunit Complex I-B18 MGC2480 NADH Dehydrogenase (Ubiquinone) 1 Beta Subcomplex, 7 (18kD, B18) MC1DN39
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_004146.6
Sequence length
535.0 nt
GC content
0.6486

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-228.10 kcal/mol
Thermodynamic ensemble
Free energy: -237.29 kcal/mol
Frequency: 0.0000
Diversity: 148.93
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((.(((((((.....)))))))..))))(((.(((((((((((....)))))))(((((...(((((((((((.((((((((.(((.(((((.((((...)))).))))).))).))))((((((....((((((((..(((((.........((((((((..(((......((((((.((((((.......((((.......(((.(.((((((((......)))))))).).)))))))..)))))).))).....(((((((...(((((((......)))...(((......)))..)))).....))))))).((.((.(((((.((....(((.(((......))).)))......)).))))).))))(((((((...))))))).)))......))).)))).))))..))))).)).)))))).....).)))))....((((.......)))).))))))))..((.(((((....))))).)))))))))..))))).......))))...)))........
Thermodynamic Ensemble Prediction
((((.(((((((.....)))))))..))))(((.(((((((((((....)))))))(((((..,(((((((((,{{((((((((.(((.(((((.((((...)))).))))).))).))))((((((....(((((({(,.(((((........,((((((((..(((.....,({{(((.((((((,......((((.......(((.(.((((((((......)))))))).).)))))))).)))))).))).,,,,((((({{...{||{,{|..,...||||,,{{{..,,{{||||.|||,.|||,}}}}}}}.{{.((.({{{,.{{.|,.{({.(((.....,))}.)))}}.,,.}),))))).))})|{{{|((...))))))).)))......))),)))).)}))..))))).)).))))))....,)}}))))....((((.......)))).))))))))}.||.(((((....,)))),})))))))).,))))).......))))...)))........

Transcripts

ID Sequence Length GC content
GUCAGUGGUUCCGGGUAGGAGCUAGGUGACCCUCGGCUGCUGCAGGGAU… 535 nt 0.6486
Summary

The protein encoded by this gene is a subunit of the multisubunit NADH:ubiquinone oxidoreductase (complex I). Mammalian complex I is composed of 45 different subunits. It is located at the mitochondrial inner membrane. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that a 7-day overfeeding intervention in lean and obese men induced differential expression of 45 genes in abdominal subcutaneous adipose tissue, including the up-regulation of the NDUFB7 gene, which is involved in mitochondrial electron transport from NADH to ubiquinone [Shea et al. DOI:10.3945/ajcn.2008.25970]. A study in rats demonstrated that the NDUFB7 was significantly altered in expression on day 1 following a 20% total body surface area burn injury, as part of a broader hepatic metabolic response where over 740 genes showed significant changes [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025].