| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUCAGUGGUUCCGGGUAGGAGCUAGGUGACCCUCGGCUGCUGCAGGGAU… | 535 nt | 0.6486 |
The protein encoded by this gene is a subunit of the multisubunit NADH:ubiquinone oxidoreductase (complex I). Mammalian complex I is composed of 45 different subunits. It is located at the mitochondrial inner membrane. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that a 7-day overfeeding intervention in lean and obese men induced differential expression of 45 genes in abdominal subcutaneous adipose tissue, including the up-regulation of the NDUFB7 gene, which is involved in mitochondrial electron transport from NADH to ubiquinone [Shea et al. DOI:10.3945/ajcn.2008.25970]. A study in rats demonstrated that the NDUFB7 was significantly altered in expression on day 1 following a 20% total body surface area burn injury, as part of a broader hepatic metabolic response where over 740 genes showed significant changes [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025].