| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCUGCAUCUGAGUAACAUGGCGGCGGCGGCGGUAGCCAGGCUGUGGU… | 894 nt | 0.5369 |
This gene encodes one of the iron-sulfur protein (IP) components of mitochondrial NADH:ubiquinone oxidoreductase (complex I). Mutations in this gene are associated with Leigh syndrome resulting from mitochondrial complex I deficiency.[provided by RefSeq, Apr 2009]
A review of human studies compiling multi-omics data for biological age estimation identified the NDUFS3 as a gene associated with epigenetic aging clocks, being part of a top list of genes linked to 11 such clocks [Solovev et al. DOI:10.1016/j.mad.2019.111192].