| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUCUGAAGGCCGAGGCCAAGAUGGCGGUGCUGUCAGCUCCUGGCCUGCG… | 1731 nt | 0.6880 | |
| GUCUGAAGGCCGAGGCCAAGAUGGCGGUGCUGUCAGCUCCUGGCCUGCG… | 758 nt | 0.6689 |
This gene encodes a protein that is a subunit of one of the complexes that forms the mitochondrial respiratory chain. This protein is one of over 40 subunits found in complex I, the nicotinamide adenine dinucleotide (NADH):ubiquinone oxidoreductase. This complex functions in the transfer of electrons from NADH to the respiratory chain, and ubiquinone is believed to be the immediate electron acceptor for the enzyme. Mutations in this gene cause Leigh syndrome due to mitochondrial complex I deficiency, a severe neurological disorder that results in bilaterally symmetrical necrotic lesions in subcortical brain regions. [provided by RefSeq, Jul 2008]
A review of human multi-omics studies for biological age estimation identified the NDUFS7 as a gene associated with epigenetic aging clocks, being part of a top list of genes linked to 11 such clocks [Solovev et al. DOI:10.1016/j.mad.2019.111192]. Separately, an experimental study in male Sprague Dawley rats demonstrated that the NDUFS7 was significantly altered in expression in liver tissue on day 4 following a 20% total body surface area burn injury, specifically within the context of mitochondrial electron transport [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025].