Basic Information

Symbol
NDUFV2
RNA class
mRNA
Alias
NADH:Ubiquinone Oxidoreductase Core Subunit V2 NADH Dehydrogenase [Ubiquinone] Flavoprotein 2, Mitochondrial CI-24k NADH Dehydrogenase (Ubiquinone) Flavoprotein 2, 24kDa NADH-Ubiquinone Oxidoreductase 24 KDa Subunit Complex I 24kDa Subunit Nuclear-Encoded Mitochondrial NADH-Ubiquinone Reductase 24Kd Subunit NADH Dehydrogenase Ubiquinone Flavoprotein 2, Mitochondrial Complex I, Mitochondrial Respitory Chain, 24 KD Subunit NADH Dehydrogenase (Ubiquinone) Flavoprotein 2 (24kD) NADH-Ubiquinone Oxidoreductase Flavoprotein 2 EC 7.1.1.2 MC1DN7
Location (GRCh38)
Forensic tag(s)
Chronological age estimation Postmortem interval inference

MANE select

Transcript ID
NM_021074.5
Sequence length
857.0 nt
GC content
0.4492

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-251.70 kcal/mol
Thermodynamic ensemble
Free energy: -269.90 kcal/mol
Frequency: 0.0000
Diversity: 165.46
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((((((.(((.(((.(((.((.(((((..(((...)))..))))).))))).)))))).))))))((((((((.(((((((....(((...)))((((.((((((.((....(((((((.....)))))))((((((((((.....))))))))))(((((..((......((((((........((((((((((.(((.((((...................((((((................)))))).....((......)).((((((((((.((((....))))...........((((((((((((....)))))).))))))..))))..)))))).((((((((((..(((((((....))).)))).....)))).))))))((((((...))))))..))))..))).))))..))))))..))))))))))))).......)).))))))))))..........(((....)))))))))).)).......)))))).....(((((((.....))).))))(((((((.(((((((((...)).))))))).)))(((((((((((.((...((((((((((((((......))).....))))((.((((((..(((((.((..((((((........))))))..))...)))))...))))))))...(((((.((..((.((((..(((((....).))))((((.((((((...))))))..).)))..))))))..))..)))))..))))))).)).)))))))))))(((((((......))))))).))))....)))))........(((....)))...........
Thermodynamic Ensemble Prediction
.(((((((((((.(({,(((.(({{((.(((((..(((,..}})},))))).))))).)))))).))))))((((((((.(({{{{|,}},|||...})}((((.((((({.((...,(((((((.....)))))))|(((((((((.....))))))))),(((({..,{,,....((((((........((((((((((.(((.((((......,............{{{{{(.,{...,,||......}}}}|}....{((.....,|{{(,.{|{{||,.,,||}}.})))},...|||....((((((((((((....)))))).))))))..,...,,{|||||.,.|,|||||||.{{{{(((....})).||||,,|||||.},}))))),|||||...))}})}..)))}..))).)))}.,))))))..))))))))))))).......,)}))))))))))......,,..(((....}))}}))}}}.}},,.....)))))).....|{((((({....,,..,)))|||,(((.(((((((({...}),})))))).)))(((((((((((.((...((((((({{({{({......})).....}}}}|{.((((((,.(((((.((..((((((........))))))..))...))))).,.))))))}}...(((((.((..((.((((..((({(......))))((({.((((((...))))))..}.)))..))))))..}),.)))))..})))))).)).))))))))))){((((((......})))))).}},,....)))))........(((....)))...........

Transcripts

ID Sequence Length GC content
AUUCUCGCCUGGCGCGGCUGGGGAAGGUGAACAGUGUGGCCCGCCAUGU… 857 nt 0.4492
Summary

The NADH-ubiquinone oxidoreductase complex (complex I) of the mitochondrial respiratory chain catalyzes the transfer of electrons from NADH to ubiquinone, and consists of at least 43 subunits. The complex is located in the inner mitochondrial membrane. This gene encodes the 24 kDa subunit of complex I, and is involved in electron transfer. Mutations in this gene are implicated in Parkinson's disease, bipolar disorder, schizophrenia, and have been found in one case of early onset hypertrophic cardiomyopathy and encephalopathy. A non-transcribed pseudogene of this locus is found on chromosome 19. [provided by RefSeq, Oct 2009]

Forensic Context

A study in *Sarcophaga peregrina* demonstrated that the NDUFV2 is a differentially expressed gene whose expression pattern increases during pupal development at 25°C and is used for precise age estimation during the intrapuparial period [Shang et al. DOI:10.1007/s00414-022-02934-7]. Transcriptomic reviews further note that such molecular markers enable high-precision age estimation in necrophagous insects [Mei et al. DOI:10.1016/J.Legalmed.2026.102801].