| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUCUCGCCUGGCGCGGCUGGGGAAGGUGAACAGUGUGGCCCGCCAUGU… | 857 nt | 0.4492 |
The NADH-ubiquinone oxidoreductase complex (complex I) of the mitochondrial respiratory chain catalyzes the transfer of electrons from NADH to ubiquinone, and consists of at least 43 subunits. The complex is located in the inner mitochondrial membrane. This gene encodes the 24 kDa subunit of complex I, and is involved in electron transfer. Mutations in this gene are implicated in Parkinson's disease, bipolar disorder, schizophrenia, and have been found in one case of early onset hypertrophic cardiomyopathy and encephalopathy. A non-transcribed pseudogene of this locus is found on chromosome 19. [provided by RefSeq, Oct 2009]
A study in *Sarcophaga peregrina* demonstrated that the NDUFV2 is a differentially expressed gene whose expression pattern increases during pupal development at 25°C and is used for precise age estimation during the intrapuparial period [Shang et al. DOI:10.1007/s00414-022-02934-7]. Transcriptomic reviews further note that such molecular markers enable high-precision age estimation in necrophagous insects [Mei et al. DOI:10.1016/J.Legalmed.2026.102801].