Basic Information

Symbol
NEFL
RNA class
mRNA
Alias
Neurofilament Light Chain NF68 NFL PPP1R110 CMT1F CMT2E Protein Phosphatase 1, Regulatory Subunit 110 Neurofilament, Light Polypeptide 68kDa Neurofilament Light Polypeptide Neurofilament Triplet L Protein NF-L Light Molecular Weight Neurofilament Protein Neurofilament Protein, Light Chain Neurofilament, Light Polypeptide 68 KDa Neurofilament Protein Neurofilament Subunit NF-L Neurofilament Light CMTDIG
Location (GRCh38)
Forensic tag(s)
Chronological age estimation Sudden death from CNS diseases

MANE select

Transcript ID
NM_006158.5
Sequence length
3584.0 nt
GC content
0.4693

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1097.80 kcal/mol
Thermodynamic ensemble
Free energy: -1169.24 kcal/mol
Frequency: 0.0000
Diversity: 939.43
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((.......(((((..((((.(((((.(((..(((((((((.(((((((((((..((((....))))(((((.......)))))((((.(((.((((((((..((((.((((((((..(((((..(((((....(((.((((((((((((((((((...))))....)))))).)))).)).)).)))..(((.(((((.(((..((((.(((((((...(((((.(((((((((((((((((.((((((((((((((...(((((((((((((...((((...(((((....(((((..(((.(((.((((....((.((........)).))...)))).)))..(((((.((((((...((((((.((((((((((((...((..((((.(.(((((....(((.((....)).)))))))).).))).)..))))))))))).)))....(((((.((((.(((((.(((((...............)))))..))))).)))).))))).......))).)))...))).))))))))....((............)))))..))))))))))...)))))))))))))))))...))))(((...))).)))))))........))).).)).)))....)))))))))).).)))))....(((..(((((((..((((.((.(..(((((((((((((((...)))))((((........))))...(((..((.((....((((......).)))..)).))..))).(((((((((((.((((.(........).)))).)).)).)))))))(((((((.((.((.(......).)).)))))))))(((((....((....)))))))(((((((.(((((.((((((((.......((.....)).......))))....).))))))))..))))))).....))))))))))..).....)).)))).)))))))..))).(((((((((........))).))))))(((((....((.(.((((((.............))))))).))..)).)))))))))))))))))))).)).))))))))....(((...(((........)))...))).......(.((..(((.(((.....))).)))..)).).....)))))..)))))..............(((((((((.((((.(((...))).)).)).))))).))))....))).))))...))).))))).)))..)))).)))).)))......(((((.(((...))))))))....((..(((((.((((((((((((....(((((((((...((.((((..((((((((.(((.....((((..(.((((.(......(((((((............................)))))))).)))).)..)))).......))))))))))).)))).))....))))))))))))).....))))..)))).))))).)).))))))).)))))).))))))))..))))..)))))(((((((...........)))))))..((((...(((((.((((.....(((((((((((((..(((((((((...((((((.......(((..((((((((((((((((((.(.((.((((((((((.(((((..((.(.......((((..((((.............))))))))...(((((.(((.......))).)))))..).))..))))).))))......((((((...(((((((((((...((((((.(((........))).))))))....)))).))..)))))))))))...)))))).)).).)).....))))))))))).))(((((.(((((......)))))...)))))(((((.....)))))((((..(((((.......)))))....))))......((((..((((((((((((..(((((........))))).....)))....))).))))))...))))..........))).)))........))))))..))))))((.((((((.......((.(((((.((.((((((.....((((((((....(((((.....)))))......))))))))(((.(((((((...............))).)))))))........))))))))))).)).)).)))))).)).............(((((....)))))....)))....)))))))))))))))))..)))))..))))(((((.(((((((...((((((....))))))....((..((((.......((((((.((.......)).))))))....(((((((((........)))))))))(((((((.....(((((.((((((((((((((((.(((((....))))).))))))))...)))))))).).)))).((((((((....(((..((((..(((((((..(((.(((((((((((..(((((..((((((((..((((.(((.(((...))).))).)..(((((((((.((((.(((((((.....))))..))))))).)))...))))))............)))..))))))))((((((((.....(((((((..(((.....((((((((......)))))))).....)))..))))))).(((((((((((((((......(((.....))).....(((((((.((((((((((.(..(((((((((((((((((..((((((....(((.......(((.((...((((.......))))...)).)))...((((((....)))))))))...)))))).......))))))))))...))).)))).).)))))))))).))))).))......(((((.((...))))))).......((((((.(((((.(((((.((((((((((...(((((......(((((((((.((.((......((..(((((....).)))).)).....))...)).)))))))))(((((((((((.(((((.((((......(((((...((..(((((....)))))..))...)).))))))).)))))..))))))))))).....)))))....))))))))))........))))))))))...))))))......))))..))))))))))).....(((((((((((((............)))).).)))))))).....)))))))).)))))...))))))).)))).)))....))))))).))))..)))....)))))))))))))))((((...((((((..............))))))......)))).))))..))((((((((((..((.((.....)).))..)))))))))).......(((((((((((((......(((.....)))......))...))))))))))).....)))))))...)))))....))))))))..........................
Thermodynamic Ensemble Prediction
((((((((...,{{.(((((..((((.(((((.({(,.(((((((((.(((((((((((({({((({{,({|{(((((.......))))))||..,,,.((((,,,,.,|{{{.(({{|,|,..,||||}...,,......||}||||..,||||,||,|||}{{||||.{{{||,,,|((((|(|..((.....,.||.,)))}}))|,{(((..{{{({((..{{((({{((((((,(((((((,,,.{,.(((((((((((...(((((((((((((...{(((,..(((((....(((((..(({.(((,(({{.,,,||.((.,......)).}},,,}}}}.))),.(((((.((((((.,.((((((.((((((((((((...{{.,.(((.(.((((({...,((.((....)).)))))))).).))).}..}})))))))))},))....(((((.((((.(((((.(((((.....,.........)))))..))))).)))).))))).......))).))).}.)))}}))))))).,.,{{,...........),)))..)))))))))).},)}}})))))))))))))...))))(({...})).)))))))......}})))})}))}).)},.})))}}}))}).),)}}))}}}.(((..(((((((..((((.((.,..(((((((((((((((...))))),{(({,.,,,{,||||...,|}}}||,,|,...||||{{{{{,|..,,..,}.)}.}))),(((((((((((.{(((,,...,....},}}}).)).)).)))))))(((((((.((.((.(......},)).)))))))))(((((....{{....)})))))(((((((.(((((.((((((({....{..{(,,...})}}.....))))....).))))))))..))))))).....))))))))))..}.....)).)))).)))))))..))),(((,({{{{{{{.,.{{(((({{({..((....({((((({(({{((,..{{....{{{{{,,,,))}))..,...|{|||||,|{||{,,(({{{||.||{|{.|.....((,...,||...}.})})),,,.)))}}....,,.((..{{{.(({.....))}.)))..}}.|,,...,,)))..,,}|}.,.....,......(((((((((.((((.(({...})).)).)).))))).))))....,}}.,|||,.{|||{..,))})),.,)))|,||||.,,}..}}}.|||||.||}}}})|||||||,,..,,..|||||.,||||,||,.}}}..}|||||||||}..,..||,.}}||||||}|.}.}}}}..}}}|,.,.,)}})}.}}}}}|(((((({.{(((((.((.{..(({{{.{{{{{...,))){{{{.{{..{{(({......)))))..))))))),.)))})..}.}),,,)))))),}.....,},,)}})))).,,,,,.}}.)))))))}}))))).))})))))..))))..)))))(((((((...........)))))))..||,{{.(((({..,(((({...((((((((((((({{((((({(((...((((((..{....{{{..{{{({(((((((((((((.,.,,.(((({{((((.(((((..({.{......,{..,..|,,,,.,||......,,,}}}}}}}...{((((.(({.......))).))))}..},})..))))).))))...,,,((((({.{{((({(({((((({,{{{{{|,|||....,.,,})).}}}}}}.||.}}}}.|,.,}))))))))))..,}}}})),}}.,,)}.....))))))))))}.||{((((,{{{{{.,,,,,)))}}..{|||,,{((((.....)))))||,{{{{,((({{{{..,,..}}.}}}}}}}.,,,|,|}|,.,((((((((({{{,.(((((........))))}...,.}}||,..,}),})))))...|}}...,|},...}}}}.}}}.....|,,|||}}|..}}}}||((.((((,........,|,|||||,({{((((((.....((((((((.,,.(((((.....}}))),,,,,.))))))))((||(((({({.,,,........,},}}}.)))))))........)))))))}))).)),))}))}}}},)),.,,,,.....,,||||{....}))))..,,}}}....))))))))))))}}}}}...{|||{,(((((((((((,{(,{,,|.{,{{{||,..{{(((,..........}},,,....{{((((.{{.......)).)))))}.,..(((((((((........)))))))))(((((({.....(((((.((((((((((((((((.(((({....})))).))))))))...)))))))).).)))),((((((((.,..(((..((((..(((((((..(((.(((((((((((..,,(((,.{{(((((,..,,{|}|||,||,.{{{||{{{,....(((((((((.((((.(((((((.....)))}.,))))))).)))...)))))).....}}}}}}},,,..||||||||((((((({.....(((((((..(({.,...((((((((......))))))))...,.))}..))))))).(((((((((((((((......(((.....))).....{,(((((.((((((((((.(..(((({((((((((((((.{(((((((({{(({{,,.,..{{{.{{...|||{...,...,))),},)}.)))}.,((((({....})))))}}|||.,,},},.,,,...))))))))))}..,}}.}))).).)))))))))).))))),||......((((,,((...)))||||,,,....|||||||{((((.(((((,((((((((((,..(({{(......(((((((((,{{.,.....}}},,.,.{{{{..,....,}..,|}|,.|{...,)}}))))))))|((((((((((.(((((.((((......((({{...((..(((((....)))))..))...)}.))))))).)))}}}.)))))))))),...,.)}}}}..,.})))))}}}}...,,...))))))))}},,,))})))......))))..))))))))))).,,,.(((((((((((((............)))).).))))))))...,,)))))))).)))))}}}))))))).)))).)))....))))))).))))..)))..,.)))))))))))))))))).)))))))).......,}}}},...,,.)))))..)))))})}||{{|,((((((((((..((.({.....)),})..)))))))))).......{{((((((({{,{|,..,,(({.,,,,}}}.......|||,|}}}}}})))).,.....,,....},})),},.,.))))))))..........................

Transcripts

ID Sequence Length GC content
GCACACAGCCAUCCAUCCUCCCCCUUCCCUCUCUCCCCUGUCCUCUCUC… 3584 nt 0.4693
Summary

Neurofilaments are type IV intermediate filament heteropolymers composed of light, medium, and heavy chains. Neurofilaments comprise the axoskeleton and they functionally maintain the neuronal caliber. They may also play a role in intracellular transport to axons and dendrites. This gene encodes the light chain neurofilament protein. Mutations in this gene cause Charcot-Marie-Tooth disease types 1F (CMT1F) and 2E (CMT2E), disorders of the peripheral nervous system that are characterized by distinct neuropathies. A pseudogene has been identified on chromosome Y. [provided by RefSeq, Oct 2008]

Forensic Context

A study in humans profiling the corpus cavernosum identified the NEFL as a gene marker specifically expressed in the fibroblast subcluster FB4, indicating a high correlation with neurons and defining its spatial localization [Zhao et al. DOI:10.1038/s41467-022-31950-9]. A separate review of human multi-omics studies for biological age estimation reported that the NEFL is positively associated with aging in whole blood samples from a cohort of healthy people [Solovev et al. DOI:10.1016/j.mad.2019.111192]. A study in rats demonstrated that the NEFL, a neuronal cytoskeletal protein, was part of a cluster of genes whose expression was inversely correlated with injury severity following contusive spinal cord injury [De Biase et al. DOI:10.1152/physiolgenomics.00081.2005].