| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCGCGCCGGGGCUGAGCGCCGAGCGGGGCGGCGGCGGGGCGGGCGGC… | 964 nt | 0.6795 |
The GDP-dissociation inhibitors (GDIs) play a primary role in modulating the activation of GTPases by inhibiting the exchange of GDP for GTP. See ARHGDIB (MIM 602843).[supplied by OMIM, Nov 2010]
A study in humans demonstrated that the ARHGDIG transcript was downregulated -1.5-fold in the dopamine cell-enriched ventral midbrain of chronic cocaine abusers compared to controls and was diagnostic for assigning subject cohorts [Bannon et al. DOI:10.1038/Npp.2014.70]. Research in mice identified the ARHGDIG as an overlapping gene in a conserved human-mouse neuronal sub-network associated with synaptic plasticity pathways [Ferguson et al. DOI:10.1007/S12035-018-1252-0].