Basic Information

Symbol
NFKBIA
RNA class
mRNA
Alias
NFKB Inhibitor Alpha IkappaBalpha IKBA NF-Kappa-B Inhibitor Alpha MAD-3 NFKBI Nuclear Factor Of Kappa Light Polypeptide Gene Enhancer In B-Cells Inhibitor, Alpha Major Histocompatibility Complex Enhancer-Binding Protein MAD3 I-Kappa-B-Alpha IkB-Alpha Nuclear Factor Of Kappa Light Chain Gene Enhancer In B-Cells EDAID2 MAD3
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Mechanical injury analysis

MANE select

Transcript ID
NM_020529.3
Sequence length
1559.0 nt
GC content
0.5305

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-543.80 kcal/mol
Thermodynamic ensemble
Free energy: -570.09 kcal/mol
Frequency: 0.0000
Diversity: 383.10
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....((((((.(((((.(((((((((..((((.((...(((.((..((.(.((((.((..((((..........)))).)).))))).)).(((((.((((............)))).)))))(((((((((......)).))).)))))).)))...)))))).....)).))))....(((.(....)))).))).))))).)))))).((((((((((.((((.(((.((((((.((((..((((((.(((((...(.(((.((((((((.((.....))..))))))))((((.(((....)))..))))...((((((.(((.(((...(((.((((((((.((((((((((.((........))...))))))..))))..)))))))).)))))).))).)...)))))..(((((((((...(((.((((((..((.........((((((.(........)))))))))..)))))))))...)))))))))..))).)...)))))))))))..)))).))..((.....))((((((((...(((...(((((((((((.((((.....)).)).))))))).)))).....))).....((.((((((.((((((((.((((((..........(((.(((..((((((((((....(((((.........)))))..)))))).))))..))).)))((((((..(((((((...........((((((....((((..((((..(((((..........))))))).))))))...))))))((((((((.((((.(((((((((.....)))....)))))))))).))..))))))(((............))).....((((....))))))))))))))))).....((((((...))))))...........))))))))))........)))))))).)).)).(((((.((((.....)))).)))))..((((((((((((((.(((((((.(((((.((((.....(((((.(.((((((.(((((..(((.(.(((.(....).))).)...))).)))))((((((....)))))).....(((((((.(((((((.............))))))))))))))...((((((....)))))).....(((...)))))))))).))))).....)))).)))))..))))..........))))))))))))))))).))))))))..........((..(((((((.(((.....(((((((.(((((((((....)))))))))..)))))))....)))..)))))))..)).(((.((((............)))).))).(((((((.((((((....(((((((.(((...(((((........)))))...)))))).)))))))))).)...))))))((((....))))((((((((((...........)))).)))))).....)))).)))....)))).)).))))))))..............................
Thermodynamic Ensemble Prediction
.....((((((.(((((.((({((({(,,{{{(((({..(((.((..{{.(,(({(.((,.{{||,...,}},..}})).)}.))))}.}|,(((((,((((,.......,,.||}||,}}}}}|||{|{{||...,,,||.}}}.}))))),))),,,))))}).....)).))))....|||.|,...)),,.))).))))).)))))).((((((((((.((((.(((.((((((.((((..((((((.(((((...(.(((.((((((((.((.....))..))))))))((((.(((....)))..))))...(((((,{(({.,{{.{((((.((((((((.((((((((((.{{........}}...))))))..))))..)))))))).)))))),}},.,}}.)))))..(((((((((...(((.((((((..,,........,((((((,{........}))))))),..}))))))))...)))))))))..))).)...)))))))))))..)))).))..((.....},((((((({...{((...(((((((((((.(({(,....}}.)).))))))).)))).....))}.,...((,(((({..{(((((({{((((((,{........{{,,(((..{(((((((((....(((((.........)))))..}))))),}))),,)}|.||)((((({..(((((((.........,.((((((....((({..((((,.{((((..........))))))).))})))...)))))}((((((((.((({{(((((({((.....})}....)))))))))).}}..)))))){{{............}|}....,((((,...)}}})))))))))}}}},{,.,(({(((...)}}}}).,.,},}....})))))))))}..,,.,.))))}))).)).)).(((({.((((.....)))).}))))..((((((((((((((,{({((((.(((((.((((....{{((({.{.((((((,((((,..{({.,.(((.(....}.))).|...}}}.,))))((((((....)))))).....,,{((((.(((((((......,,,,,,,}))))}},}}}}}}...((((((....)))))).....((,...,)}})))))}.})))).}...}))).)))))..)))),,,...,}}}),))))))))))))))}.}))))))).,.,......|(,.(((((((.(((..,..(((((((.(((((((((....)))))))))..)))))))..,.)))..))))))),.||,({{.((((..........,.)))),))).(((((((.{(((((....(((((((.{((.|.{((((........))))}.}.)))))).))))))))))....,))))))((((....)))){(((({{((({..........)),)})))))}.....)))).))}....}))).)).)))))))).{(({.,...........,,....}}},..

Transcripts

ID Sequence Length GC content
ACAGCAGUCCGUGCCGCCGUCCCGCCCGCCAGCGCCCCAGCGAGGAAGC… 1559 nt 0.5305
Summary

This gene encodes a member of the NF-kappa-B inhibitor family, which contain multiple ankrin repeat domains. The encoded protein interacts with REL dimers to inhibit NF-kappa-B/REL complexes which are involved in inflammatory responses. The encoded protein moves between the cytoplasm and the nucleus via a nuclear localization signal and CRM1-mediated nuclear export. Mutations in this gene have been found in ectodermal dysplasia anhidrotic with T-cell immunodeficiency autosomal dominant disease. [provided by RefSeq, Aug 2011] CIViC Summary for NFKBIA Gene

Forensic Context

A study in humans demonstrated that the NFKBIA was significantly up-regulated in heart failure patients compared to non-heart failure patients following acute myocardial infarction, with RT-qPCR validation showing a high predictive accuracy (AUC 0.927, 95% CI: 0.867–0.988) for identifying AMI patients at risk of HF [Liu et al. DOI:10.1042/BSR20222552]. Another study in elderly hip fracture patients identified the NFKBIA as a highly expressed inflammation-related gene in naive B cells at 24 hours post-operation [Lu et al. DOI:10.1186/s12979-023-00380-6]. A study in rats demonstrated that polytrauma (osteotomy, chest trauma, and burn) significantly upregulated the expression of the NFKBIA (Nfkbia) mRNA at the fracture site 24 hours post-trauma compared to osteotomy alone, indicating an altered local immune response associated with delayed bone healing and a perturbed systemic inflammatory profile [Mangum et al. DOI:10.1186/s13018-019-1082-4].