| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAGCAGUCCGUGCCGCCGUCCCGCCCGCCAGCGCCCCAGCGAGGAAGC… | 1559 nt | 0.5305 |
This gene encodes a member of the NF-kappa-B inhibitor family, which contain multiple ankrin repeat domains. The encoded protein interacts with REL dimers to inhibit NF-kappa-B/REL complexes which are involved in inflammatory responses. The encoded protein moves between the cytoplasm and the nucleus via a nuclear localization signal and CRM1-mediated nuclear export. Mutations in this gene have been found in ectodermal dysplasia anhidrotic with T-cell immunodeficiency autosomal dominant disease. [provided by RefSeq, Aug 2011] CIViC Summary for NFKBIA Gene
A study in humans demonstrated that the NFKBIA was significantly up-regulated in heart failure patients compared to non-heart failure patients following acute myocardial infarction, with RT-qPCR validation showing a high predictive accuracy (AUC 0.927, 95% CI: 0.867–0.988) for identifying AMI patients at risk of HF [Liu et al. DOI:10.1042/BSR20222552]. Another study in elderly hip fracture patients identified the NFKBIA as a highly expressed inflammation-related gene in naive B cells at 24 hours post-operation [Lu et al. DOI:10.1186/s12979-023-00380-6]. A study in rats demonstrated that polytrauma (osteotomy, chest trauma, and burn) significantly upregulated the expression of the NFKBIA (Nfkbia) mRNA at the fracture site 24 hours post-trauma compared to osteotomy alone, indicating an altered local immune response associated with delayed bone healing and a perturbed systemic inflammatory profile [Mangum et al. DOI:10.1186/s13018-019-1082-4].