Basic Information

Symbol
NFKBIZ
RNA class
mRNA
Alias
NFKB Inhibitor Zeta MAIL INAP IL-1 Inducible Nuclear Ankyrin-Repeat Protein NF-Kappa-B Inhibitor Zeta Nuclear Factor Of Kappa Light Polypeptide Gene Enhancer In B-Cells Inhibitor, Zeta Molecule Possessing Ankyrin Repeats Induced By Lipopolysaccharide I-Kappa-B-Zeta IkappaBzeta FLJ34463 IkB-Zeta IKBZ Molecule Possessing Ankyrin‐Repeats Induced By Lipopolysaccharide IkappaB-Zeta
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses Mechanical injury analysis Wound age identification

MANE select

Transcript ID
NM_031419.4
Sequence length
3923.0 nt
GC content
0.4621

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1227.00 kcal/mol
Thermodynamic ensemble
Free energy: -1300.30 kcal/mol
Frequency: 0.0000
Diversity: 1184.48
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((..((((((.((.(.(((((...(((((.((.((..((((((((((..((((((.((((.(((..(((.(.(.(((.(((((((((((((.((.((((...)))).)).)))....)))).....(((((.(((..((((.((((..((((((((.((((((((((((((((((.((((((....((..((...(((((...)))))..))))...))).))).)))))))))))).....((((((.(((......))).))))))))))))))))))))..))))))))))).))))))))))).))))).))).)))..))))..)).))))..))))))).))))))).)))))..))).)).).))))))))..((((...))))..))))))..((((((.....))))))((..((((((((.(((..((..((((..(.((((.......)))).)..))))))..)))))))))).)..))((((((((..((((..((((...))))...))))..)))))))).(((.(((((((((((((........)))))....((((.......)))).(((.((((((.((.((..((((((............(((((.(((((.(((.......((((((((..(((((((((...((((((((.......................((((.((((((.....)))))).)))).......((.....)).((((((.......))))))................)))))))))))))))))..........(((((...)))))....)))))))).........)))))))).)))))((((.......))))...(((((((((..((((((((((((((..(((((.......))))).)))........(((((((((((((((((((.((((...((((((((((........(((((..((((...(((((((..(((((.((....))....))))).((((((((.......(((......))).((((((((..(((((........((((..((((.......(((((((((.(((((...........(((((.........(((((.(((((((..((.....))))))))).))))).....(((.........)))......((((..((..(((((((((.(((((((((((((((((.((((((.((((..(((..((((...))))..))))))).))))))....(((..((.((((((..........((((.((...((((((....))))))...)).))))........))))))))..))).........)).)))))).)))))....(((((.((((((((.............).))))))))))))..((((.((.(.((....))))))))))))).)))))))))..))..))))..)))))(((((...(((....))).))))).((((.....))))....))))))))))))))((((..(((...(((((((((((.((((((....))))))..(((((((..((((((((((..(.(((((..((((........))))..))))).)..)))).((((.......)))).))).))).))))))))))))).)))))))).))))))))))))........)))))..))))))))......))))))))....((((((.........(((.((.........)).)))((.((.((((((.(.(((((....))))).).))).))).)).)).........)))))).....)))..)))).))))....)))))........)))))))))).....))))..))............))))))).(((((.(..((((....)))).....).)))))....))))).)))))(((((((((((.((.(((.........))).)).)))))....))))))...((((((((((((((((....)))))))...)))..))))))..))))))))))).((((((......))))))..(((.((((((......)).)))).))).(((((((.((...(((((........(((((((((..((((.((((.((..((....))..)).)))))))).....((((......)))).))))).)))).(((((.(((...))).)))))......))))).)).)))))))((((......))))((((((((.(((........))).)))))))))))))))))...((((....)))).((((((((.......))))))))....(((((((...)))))))........(((((((((.....(((((((((((((((.(((((..((((..((((((...(((((((..((((....(((............(((((.(((((...))))).)))))...((((...(((((....)))))...))))....((((.((....((((((((.((((((((..((((.((((((...(((((((...((((((((((((.(((((((...(((((((...((((.(((((....(((....(((((((((.(((((...((((...(((((((((((((......))))))......((((((...(((((..((((((..(.((((((....)))).)).).....))))))..))))).(((((.(((((.......((((.((.....((((((((....))))))))...)).)))).(((......((((..(((....))).))))......))).........))))).)))))(((((((....((((....))))...)))))))..(((((((((........(((....)))...((((....))))...((((((((.(((((..((((((....((((((....((((.......))))....))))))((((...(((((.((((..................)))))))))..))))....................(((((((((((...))))))....((((.((((.(((..((((((.((((((((.((((((.(((((......))))).)))))).))...((((((((..((((........)))))).))))))..........(((((..(((...........)))..))))))))))).))))))..))))))).)))))))))))))))..)))))...)))))))))).))))))))))))).)))))))...))))(((.((((((((((((((..((((...))))))))))(((((.....)))))..)))))))))))......)))))..))))))))))))...))))).))))....)))))))...)))))))........)))))))..((((((........))))))..)))))..)))))))....))))))(((((((.......))))))).)))).)))))))).....((((((......)))))).....)))))))))).))))))))))).)))))))))))))..))))..............))))).)))))....)))))))))).....(((((((((((.....)))))))))))..........)))))))))(((((((......((((......)))).......)))))))))))))...))..)).)))))).))).......(((((...))))).((((....)))))))))))).)))........(((((((.(((........))))))))))...........((((((.....))))))....)).....
Thermodynamic Ensemble Prediction
,,{(((((..((((((,((.{.(((((...(((((.((.((..((((((((((..((((((.((((.(((..(((.(.(.(((.(((((((((({((,((.((({...}))).)).}}}.,,.)))).....(((((.(({.,((((.((((..((((((((.((((((((((((((((((.((((((....((..((...(((({...}))))..))))...))).))).))))))))))))....,((((((.(((,...,.))).))))))))))))))))))))..))))))))))).))))))))))).)))}).))).)))..))))..)).))))..))))))).))))))).)))))..))),)).).))))))))..((((...))))..)}|}||,{((((((....,)))})}((,.{(((((((.(((..,({,((((..(.((((.......)))).)..))))))..)))))))))).}..}}((((((((..((((..((((...))))...))))..)))))))).{((.(((((((({((((......,,|||||,,{.,,,,.....,{{{{{,{,{{{{{{({,(,,,,{{,..(((({{..({{({{{{{{(({(({({{(({,,....,{{{{{({{,,({((({(((,,.,,,(((((.......||,,............||||||{|{{{,,...}}||||.||||..||,.,{{.....}),|{((((,.,,,,.}}}}}},.|,,,,,..,,..,,}}}}}}})))))}||||,..,{{..,.(((((...))))).}..)))}))))}..{{((((((.(((((..((..((((.......))))..))...))))).)))))).))}}|||}}}{{||{...,,,,||},|{|||..,,..{{({,{{{{|||(((((((...,,{{.,.{{{((((((,..||,,.,{{(({,,(({{..|{||,.,{|.{(({{.|{.,..}},...}}}},.((((((((.....,,({,...,,,,}}.,(((((((..(((((........((((..{(({.......(((((((({{(((((...........(((((.........(((((.(((((({.,((,...,))))))))).)))))....,(((.........))),...,.((((..((..(((((((((.((({(((((((((((,{.((((((.((((..(((..((((...))))..))))))).))))))..{,(((,,({.{((({{..........{{||.{|,,,{{|||,....|}|}}}..,)}.))}}........})))}))}..},}.,,......)))))))))}})))){{{{(((({.,,,((((.,......,.}}}}..,,,}))))))))..((((.{{.,.((....))})})))))))).)))))))))..))..))))..))))}(((((...(((....))).))))).{({{.....}}},....))))))))))))))((((..(((...(((((((((((.{{((((,,..})))))..(((((((..(({,((((((,.,.(((((..((((.,....,.))))..))))}{{{.,,,)}|((,.......))))))))}))).)))))))))))))}}))))))).))))})))))))........)))))..)))))))}......))))))))....{{((((......{{{{(({,(({{{,......,|||{,|{||,|||||||.(((((....))))),|,.||{{||.||{.|,........}}}}},,,,..}}).,))))})))|{{,,||}}}..,..,,,))))}||||}...},)),,..||{{{|,,.{{{,.}|||}}}.(((((.{..((((....})))....,),)))}}....)))}|({|{{((((((((((((.((.{,,.,{{,....,}}.}}.}}}}}..,,)))})}}.,|{|||{,((((((({(....}||||||,..||}..|||||,.{||||.||||((({(((((((({..((((((((,((((...)))),.)))))))),.||,,,.{{{{{.((...(((((,,,,({,,((.{{{({..,||{{.((({.{{.,((,,,,||..}},|}}}}|}}.|{,,{{((,{{,..||||.|}}|},}..,,(((((.(({...})).))))).....,|||||.||,|}}},((((((......))))))|||}|,|||}}}|...,{|||{.,,,,)})))}.(({,{{((,,..}}||}||,,((((((((.......))))))))...{(((((((...))))))),}.....{({((((((((...)))))))}}}}.,,....{{{,((,,(((,,....,},..)))}))))}|||}.,}})).,.,,,,...{{(((,,.,||||}..|}||,.,,}}}...{(((...(((((....)))))...)))},,..,{|||||||||}.,,.||))))}))}}}}},|||,}}}}}..,{{{{{,,,,,{{{.{{{,{{{{,.,,.}}}}}}||||}|.,,|}|,,|||||{{{,,.,,,,...}},}||},|,|||...,|||,,.,.|||,(((((((((......))))))))),,}))))|}}|.|||||.,||||{|}}|,{,,{||}}},)))..})))}}.}}}))))}.,|||||,,,,|||||,,|.|,,}}}}}||,,.,,,}}{(((((({....)))))))).,,,|||{{{{|(({{{,.|{{{({|{({,|{,|||,}}}},,..},}},,....,,{{{{{{{,.{({{(((((((....{(({....}}))...))))))){{{{{{{.{{{,{{{|,.|((({{{{{{|,{{{||,..||||}}...{{{{{{||,|{{{{.,(((({{,,,,{{{|||.||,|{{{.,,....,}}|....}}||||((((..,(((({.((((...,,........,,...)))))))))..)))).}},,.....,,,}}}}..}}}}}}|{||||,..)))))}...,{{{{,{(({.{{{..({((((.({{{{(((,((((((,(((({......|||||,|}|||}.}}...|||{||||,,|{{{|,,,...,))},}}.}|||||.{,,.,,,,.(((((,,.{{...........,,),.)))))))))}}.)))))),.))}}}||,|}||,,.,,|}}}}}..))}))...)))))))))))}|||||,.(((((......)))))..||{{{|{{(((((|{{{{{|,.||||,,,))).)))))){((((.....)))))..}))))))),,,.{{({...,}}}...,{{((||{{,|{(((..((((((((.(((((.......))))).)))))))).)))),,..)}}})))),..,}})))}}},,|||||||,,,}.})}}},)},||,(((((((.......)))))))..,{{({{{,.....}}}}}|{{{{,.....},,,,,,,,,.,||.{{.{(((...)))).)),,))))}}}||||,|||||.,|||}}}}||,{{,(((((({.................)))))))(((((((((((.....))))))))))),}},.}}}.))))))}|||||}||....))}))))))),,...,|||||,,..,}}}),,,.,))))})}})}))}...)))))))}).}}},||||{,..}|||,.,,,,}||,},,,})))))}}.}}}.....,.,||{||||.{{{..,,,.{,||,}}}}}}))},...,}||,{(((((.....)))))}..,,},.....

Transcripts

ID Sequence Length GC content
CUCCUCUUGCCACGAGGUCAGACGGCGAGUUCUUAGAGAAAAAGGCUGC… 3790 nt 0.4296
GUACUGGCCCGCGCCGUCCGCCCGCCGACAGCUCCCUGAGCCAGCCCGG… 3923 nt 0.4621
Summary

This gene is a member of the ankyrin-repeat family and is induced by lipopolysaccharide (LPS). The C-terminal portion of the encoded product which contains the ankyrin repeats, shares high sequence similarity with the I kappa B family of proteins. The latter are known to play a role in inflammatory responses to LPS by their interaction with NF-B proteins through ankyrin-repeat domains. Studies in mouse indicate that this gene product is one of the nuclear I kappa B proteins and an activator of IL-6 production. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] CIViC Summary for NFKBIZ Gene

Forensic Context

A study in mice demonstrated that methamphetamine administration significantly up-regulated the mRNA expression of the NFKBIZ in heart tissue, indicating activation of NFκB signaling and an inflammatory condition associated with myocardial damage [Shinone et al. DOI:10.1016/J.Legalmed.2010.01.001]. In a separate murine model of brain injury, single-cell RNA sequencing revealed that the NFKBIZ exhibited reduced expression in monocytes from clodronate pre-treated, injured mice, correlating with a shift toward a protective, anti-inflammatory phenotype and improved neurological outcomes [Gudenschwager Basso et al. DOI:10.1186/s12974-024-03032-8]. A study in mice demonstrated that the NFKBIZ was upregulated in gastrocnemius muscle at 1 day after a local hind limb burn and at 6 hours, 12 hours, and 2 days (with downregulation at 7 days) after a distant dorsum burn [Padfield et al. DOI:10.01.ta.0000230567.56797.6c]. In a separate study, leukocyte gene expression analysis in mice identified the NFKBIZ as being upregulated in common in spleen leukocytes across three models of systemic inflammation—burn injury, trauma/hemorrhage, and LPS infusion—at 2 hours post-injury [Brownstein et al. DOI:10.1152/physiolgenomics.00213.2005].