| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCCUCUUGCCACGAGGUCAGACGGCGAGUUCUUAGAGAAAAAGGCUGC… | 3790 nt | 0.4296 | |
| GUACUGGCCCGCGCCGUCCGCCCGCCGACAGCUCCCUGAGCCAGCCCGG… | 3923 nt | 0.4621 |
This gene is a member of the ankyrin-repeat family and is induced by lipopolysaccharide (LPS). The C-terminal portion of the encoded product which contains the ankyrin repeats, shares high sequence similarity with the I kappa B family of proteins. The latter are known to play a role in inflammatory responses to LPS by their interaction with NF-B proteins through ankyrin-repeat domains. Studies in mouse indicate that this gene product is one of the nuclear I kappa B proteins and an activator of IL-6 production. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] CIViC Summary for NFKBIZ Gene
A study in mice demonstrated that methamphetamine administration significantly up-regulated the mRNA expression of the NFKBIZ in heart tissue, indicating activation of NFκB signaling and an inflammatory condition associated with myocardial damage [Shinone et al. DOI:10.1016/J.Legalmed.2010.01.001]. In a separate murine model of brain injury, single-cell RNA sequencing revealed that the NFKBIZ exhibited reduced expression in monocytes from clodronate pre-treated, injured mice, correlating with a shift toward a protective, anti-inflammatory phenotype and improved neurological outcomes [Gudenschwager Basso et al. DOI:10.1186/s12974-024-03032-8]. A study in mice demonstrated that the NFKBIZ was upregulated in gastrocnemius muscle at 1 day after a local hind limb burn and at 6 hours, 12 hours, and 2 days (with downregulation at 7 days) after a distant dorsum burn [Padfield et al. DOI:10.01.ta.0000230567.56797.6c]. In a separate study, leukocyte gene expression analysis in mice identified the NFKBIZ as being upregulated in common in spleen leukocytes across three models of systemic inflammation—burn injury, trauma/hemorrhage, and LPS infusion—at 2 hours post-injury [Brownstein et al. DOI:10.1152/physiolgenomics.00213.2005].