Basic Information

Symbol
NFYA
RNA class
mRNA
Alias
Nuclear Transcription Factor Y Subunit Alpha NF-YA CBF-B HAP2 Nuclear Transcription Factor Y Subunit A Nuclear Transcription Factor Y, Alpha CCAAT-Binding Transcription Factor Subunit B CAAT-Box DNA Binding Protein Subunit A CAAT Box DNA-Binding Protein Subunit A Transcription Factor NF-Y, A Subunit HAP2 CCAAT-Binding Protein NFYA Transcript CBF-A
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Other applications

MANE select

Transcript ID
NM_002505.5
Sequence length
6209.0 nt
GC content
0.4632

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2023.07 kcal/mol
Thermodynamic ensemble
Free energy: -2133.82 kcal/mol
Frequency: 0.0000
Diversity: 1733.95
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
........((((.((((((.((((.(((.(((((((((((((((((.......))))))...((((((((((((...(((((((((((((....((((((((((((((.....(((.....))).(((((((.....((((((.(((((..(((.(((.((((((((((....((((((........)).....(((((.((((....))))..)))))(((((.....)))))...(((((.(((((.(((.((((((...)))))).))).))))).).))))((((.((((((...))))))..))))......))))..)))))))))).((((((((((((((.....(((..((.....((((.((((((.............))))))...))))..))..)))))))).))))..)))))..(((...)))....((((((..(((((.........))))).))))))......((((((.((((..(((((((.......).))))))..)))).))))))(((((((((((((((((.........(((((..(((((((((...((((((......))))))..((((((..............))))))((..((((((((....)))))))).))(((..(((((.(((.((((........)))).)))..)))))..))).......((((((((((.((..(..((((...))))..)..)).(((((((..((((.((.((((...))))..(((((.....))))).....((........)).......(((....)))))..))))(((((((((.(......)))))))))).....))))))).....))).))))))).))))))))).)))))))))))))))))))))).......))).))).))))))))))).(((((.((((......)))).)))))....((((((..............)))))).....))))))).(((....)))...(((..((.(((.(((....((((...(((((((((((..(((((.(((.......((((......))))....((((....))))))).))))).....)))))))))))...)))).(((((((...((((..(((.((((.((.(((((((.((((((...(((((.(((((((((((..(((((((((....(((.....)))..((((.(((((((..((.((...(.....)...)).))..))))))).)))).....))))))))))))))))...(((((.(((.......))).))))).(((((((........)))))))...((((..((((..((.(((((..(.........)..)))))..))..))))..))))....(((((.(((.....))).))))).)).)).)))))...)))))).)................((((((((((...(((((((.((.(((((((...((((.(((.((...(((((.(((((.......(((((((((((......))))))...........(((.((((...(((((((.((((..(((.((((......(((.(((......((((((....))))))........))).))).....))))....((((((((..((((((((((((......)))))..)))))))..))))))))..........(((.((((((((.(((.(((.((((.((((..................))))))))))).))).)).)))))).))).((.(((..((((((((...((((.((.(((..................................))).))))))..)))))))).)))..)).)))..)))).)))).)))...)))))))..(((((.....))))).......)))))))))))))))..)).))).))))((((((....))))))......(((((((((.(((((((((.................))))))))).........((((((((...))).)))))..)))))))))....(((..((((...)))).))).))))))))).))...)))))............)))))))))).(((.((.((((((((..((((((((.((((.(((((...((((.(((((((((((.((((.......))))..((((((((((..(((((....((.(((((.((((....))))..(((((((.......)))))))(((((((((.(((((..(((...(((.(((((.(((((.(((.(((............)))..(((((((..(((((..(((((.(((..(((((.((((((.........))))))..(.(((((((.((((........(((((...)))))........)))).))))))).))))))..))).))))).)))))..)))))))))).))))).))))).))).)))..)))))....))))))))).))))).))))))))))).))))))...((((((.(((.......)).).)))))).........(((((........))))).))))))((((((((...((((.((((((((((..(.((((.....((((((...(......)...)))))).((((..((...))..))))(((..((((((...((((((..(((....))).))))))(((.....))).(((((........)))))))))))..))).((((((((((......))))...))))))........)))).)..))))))))))))))...............))))))))(((((...(((((((...(((((........)))))(((((..((.((((((.....(((...)))..)))))).))...)))))..)))))))...))))).(((((....)))))((((..(((((((((((((.(((.((.....)).)))))))))))))))).))))..(((((..((((...((((((((....))))))))......))))..)))))..)))))..))))............((((((((((((((((.((((....)).))))).)))))).((((((.........)))))).(((((((((((..........((((......)))).............(((((((((.(...(((...(((((((((((((..(((........))).....))))))))))))).)))((((((.......).)))))....(((((.((...((((((.((((((((((..(((((((((((((((..(((...(((..((.(((((((((.(((((((((((((.(((.(..((((((........))))))..).)))))))))))))))).)))...(((((((((.....))).))))))(((.......))).............(((((..........................)))))))))))))..)))...))))))))))))))).)))..)).......)))))))))))))).)))))))(((((.(((((..((((((...((((((.((......)).))))))((....((((((......))))))...))....)))))).))))).)))))........(((((((((((((.....)))).)))))))))..((((((......))))))((....))..((((..(((((..(........)..))))).))))......).))))))))).(((((((((((((....)))))).)))).))).....))).))))))))....))))))).)))))..)))).))))))))...))))))))))...)))(((((......((((.(((((((((((((.(((.((((.(((((........(((((((.((((......))))..))))))).((((((((..(((((((....)))..))))....))))))))....((((.....(((..(((((((..((((..((((..((((..............((((((((((((((((((....).))))))))))).......))))))...............))))..)))))))).....)))))))..)))....))))((..((((..(......)..))))..))...((((......)))).................))))).(((......))).......((.((((.....)))).)).)))).))).))))))))...))))).)))))))))..(((((((((((((........)))...))))....))))))..)))))).)).))))..)))..))))...)))))))(((((....(((((..((........))..)))))))))).((((..((((((((((((((.....................)))))..)))).)))))..)))).))).)))))..)))........))))))))))))))...((((((.(((((.((((.((..((((((((...(((((.......)))))...)))).).)))..)).)))).))))).(((....)))((((((..((((.(....))))))))))))))))).....((((.(((((((((.((.....)))))))))..)).)))).)))))).))).)))))))......)))))))))(((((((((..(((((((.((.((((.(((........)))))))...)).))).))))..)))))))))((((((..((((((.((((....))))....))))))(((((((.((((((...((((....((.(((((.((((((..(((((((.((((..(((.((((((..(((....)))..)))))))))....(((....))).(((((((((((((((((((((((((...((...))))))).))))))))....))))...))))))))((((..((((((((...)))..)))))..))))(((...)))..((((((((.(((((.(........).)))))(((((((.(((.(((....(((((.....))))))))))).)))))))...........))))))))....)))).)))..))))..)))))).))))).)).....)))))))))).)))))))............((((..(((....(((......)))....)))......))))...(((((.........))))))))))).))))))))))).))).))..)).))))))))))(((((((((((.(..(..((((.......))))..)..).))))).(((((.((((..(((..(((.((((((.(((.((..(((....)))..)).))))))))))))..)))..)))).)))))...((((...)))).((((.(.(((..(((((((((....(((((..........))))))))))))))(((((((((..((((((((...(((.((..((((((((((((.((((((.(((((((((((((((((((...(((..((((....)))).))))))))))))).(((((....((.(((.((((((((((((.........)))))))).)))).)))))...)))))........(((((...(((.((...(((((.(((((.(((((((((..((...............))..))))))))).))))).)))))....)))))......((((((((((((((..((((((....((((((((((((...)))...))).))))))...))))))))))))))).))))))))))..................)))))))))..((((((......)))))).((((((....))))))..............)))))).))....))))))))))..)).)))))))...))))....))))))..))).)))).)))).........))))))((((((...(((((((((((.(((((.....)))))))))......((((((((((....)))))))))).)))))))))))))..
Thermodynamic Ensemble Prediction
,...,{{.((((.((((((.(({{.(((.(((((((((((((((((.......))))))...(((((((((({{..{((((((((((((((({.(((((((((((((.(((,.(({..,,,}}}.{{{{(((,((.,,,|||||{{((({{((...{,.((((((((((.,,.((((((........}}..,,{(((((.((((....))))..)))))|||{{.....)}}||...(((((.(((((.(((.((((((...}))))).))).))))).).))))((((.((((((...))))))..))))..,...)))),.)))))))))),|((((,,((((((({....{((,(({((((.((((.((((((.............))))))...)))).{|{{{{{{|||||{||||{{,||||..(({...}))....{((({{..(((((.,.......})))).}))))){{,..,((((({.((((..(((((({.......}.))))))..)))).})))))||||||||,,((((((({({{,....|||,{..({{,,,,,|...((((((......))))))..||||||}}}..........,||{|||,...||||||||}}}})))))),|,{{({{..,,{|{|({{.{{||,|......)))).}},{{{{|||{..|{{{{.{(,(,,,,,,,,,{(({.({{((((...||||,,|||||.,,((((({{(((({(.{((,..((((((.{(((,.{{{{.,((((......)))}.,{{,.{{{(.(.{(((....||{{{,,||||(((((((((.(......})))))))))..,{{||,|||,,{{{,|||{{{{|||,,.||||||||,||||{{||||||,||||||{{{{,{{{...,,.{((((({.{{{,(((((....}))}|........((((((((....((((((..............))))))...}})}})))).,((,,..|}|...},.|,))}}},,))}}...{|{{...(((((((((({..,.||{(({((,{,,{{{{{{.,,{{.}|||.,{,((((....)))),),..||}||||,.|||||}}}}}}...)))},,)}}},|}|,||...((((..((((.,.,,,..{{.{(((((...(((((.({{,(((((((..{((((((((....(((,...,)))..((((.(((((((..((.{(...(.....)...)).))..))))))).)))).....))))))))})))))))...(((((.(((.......))).))))).(((((((........)))))))...((((..((((,,((,((({(..,.........}..))))),,}}..))))..))))....(((((.{((.....})).))))).,).)).)))))...)))))))).}}.))))..)))).}),)}),}},}),,|||||||||,.|,,,..{,{{(((((......)))}},|||||||}||||||...{{{((((((......)))))}........||||...}}|},,.,}},}}}.}}}.}}}}}}}..,})),,.,.}}}.}}}}}..((((((....)))))),{{{,....,,,||,.{,{{,{{|,.....,(((((,,((((((((((((......))))),.}))))))..)))))((((........)))),||||,..,,|||}|||.}}.})))}.......}}},}}},)))})))))),,)))).))))).)}}|})}),.}}}}.)))))).....)))....))})))})))..}}}}.,,{({.{{..(({..............})).}}.}})}}|||||..}}}},}}}}))})))))).))))))})),)))))}}}}}|||,..}}})))))}.,,,..{((((((({{{{,,....,.....}}}}((((((....)))))}...{{((((({{,,,.{((((((((...,.....,,..,..,|||}}}}}},,}}.....((((({{,...,}}.)))))...((((((((((({(((..(((,...,})).}}}{{{..|{{{.{{(((.((({...,,......}})).))))))),,}..))}((((((((..((((((((.{(((.(((((.,.((((.((({{{((((({{({,.,|,,.,,||,..(((((((((((.{((((,.,,,{.{{{|||||,,....}}}}..(((((((.......))))))),((((((({.(((((..(((...(((.(((((.(((((.(((.(((..{{.....},.)))..(((((((.,((({{..(((((.(((..(((((,((((({.........}))))).}|.{((((((.((((,.......(((({...}))))......,.)))).))))))}.})))))..))).))))).))))}..}})))))))).))))).))))).))).)))..)))))....,)))))))},})))).))))))}}))).))))))...((((((.{{{.......}}.).)))))){,{{,{...{|{||}}.|||||}},,),)))))}((((((((...{(((,((((((((((..{.((((,,...({((((,,,(,,....}...}}})}}.{(((..((...)),,)))|{{{,.{{{((,...((((((..(((....))}.))))))(((.....))).{{{{{.....,}})))))))))})..))).((((((((((......))))...))))))..,,....}))).,..}))))))))))})}.......,,....,.))))))))(((((...(((((((...{((((........))))|(((((..((.((((((.,..,({{...))},,)))))).))...))))),.)))))))...))))).(((((....)))))((((..(((({((((((((.(({.((.....)).})}))))))))))))).))))..(((((..((((.,,((((((((....))))))),,}}...))))..)))))..)))))..))))............((((((((((((((((.{{((....)).}}))).)))))).((((((.........)))))).(((((((((((.,,{..,,,.((((......))))........,....(((((((((.{...{((...(((((((((((((..{{{..,.....,)).....))))))))))))}.}},((((((.......).))))}....(((((.((...(((({((((((((((((..(((((((((((((({..(((...(((..((.(((((((((.(((((((((((((.(((.{,.((((((.....,,.)))))).,},))}))))))))))))).)),...(((((((((.....))).))))))(({.,....,))).............,((((...,,...,,.........,.,,...)))))))))))))..)))...))))))))))))))).)))..)).......)))))))))))))).))))))),((((.,,,||}}{{(({{..,({{{{|,|{......,,.})))))|,....((((((......))))))....|,{{{}}||}},}}}}}.}}}||{{{{....((((((((({(((.....}))}.)))))))))..|{,,||},,,.,)))})))},},}}}},((((..(((((..(........)..))))).))))......}.))))))))),(((({{{{{{{|(,,,.))}})).)))).))).....))).))))))))....))))))).)))))..)))).))))))))...))))))))}.})))))))))))..{{{||,|}||,{{|,,,{||||,|{.{{||((((((........{((((((.{(((......)))),.))))))}.((((((((..(((((((....))),.,)))....))))))))....)))))}..|}|..,}}}}}},,},))))})),((((((((.....)))))))){{{{{{((((((((((({....}.)))))))))))...,...}}}|||{......,,.))))))))|||{..(((((...((((({..{(,...|||,{{{(((..((((..(......}.,)))}.,)}},,((((......)))).........}.,..}}))))..))))).,}},((({....}))).||{{..,,,))))|||,}}|,.|{.(((((......)))))),,..,,.}}}..{{{{{,,,,{{{{..,||{{.}}},,,||||||||}}},,,.))))))))),,},,,,.}))).,)))).})))))),(((((....(((((..((........))..)))))))))).((((,.....}))),|(({....,}}.....,,.,,||,..,.}))}.)),}))))))))}}))))))).})).,{.{{.,{{{...,}))}})).},,,,...((((((.(((((.((((.((..((((((((...(((((.......)))))...)))).).)))..)).)))).))))).(((....)))((((((..{(((.{....))))}))))))))))))....,((((.(((((((({{({.....)})))))))..)).)))),)))))).)))}}))))}}...}.,)))))))))..((((((({.,,,,,(({(({{{,((((({...{{{.(((((((...{{(((((....))))))))..))))))),.((((((.((((....))))....))))))(((((((.((((((...((((....((.(((((.((((((..(((({((.((((..(((.((((((..(((....)))..)))))))))....|{{{{{{|||,{(({({{((((({{((({{(((({{..|||,.}}}}}))),)}})}))}..,,)))}..,|||||||{((((..(((((,(,...,,,..)))))..)))){{{...}}}..({{{(({{.{{{{{.{.....,,,)})))),((((((({(((.(({...,(((((,...,)))))))).))))))))))...........}})))})),...)))).}},..))))..)))))).))))).)).....)))))))))).)))))))...........,{{{{..,||,,,.,,,......,.,,},..,}.....,}))}).}|}|)}})}..,....))))))))...))))))))))).)))..},.)).)))))))))){{|||,,,,,,....,..{{{{.......|}||,,|{{|,,||||{((((({(,,,..((({{(((,((((((.(((.((..(((....)))..)).)))))))))|||{.,|,..,),.}))),,...|))))},))).{((,({({(({,{(((.,((((({..(((({.,{{(({{{((,|(({,.((|,.....|)).)})}.))}||})))}|{({{{{,((({((({{(((,{(((((,(((((((({(({(((((({..,({{,.((((....}}))||||}}|}}|||||(((,,((((((((.....)))))))},,|}|.,(((((((({{,(((((...((((((....(((({.{,,,,{,,,,,..,,}},|,,,|((((.{((((.(((((((((..((..{......,.....))..))))))))).))))).))))}.,},,}.}}}}}....))))))...)))))..,,}.}))))))).},||..||||}||.},})),}))})})},}}}),,)},)))})))})))),))),))))))))},......{{{|||||||,,..((((((......)))))).,{{{||,,..)))))).........,,.,,}}))}}.}}....)}})))))))...)))))).,)))).)))}},.))),},...,)))))}.))))}.}}))}..}))),){(((((..{((((({{((({{(((((.....}))))))))......((((((((((....)))))))))).))))),,)))))}..

Transcripts

ID Sequence Length GC content
GCUAGGCAGCGGCAGUGGCGGCGGCAGCGGCGGCUGGAGCCUCUGAUUG… 6209 nt 0.4632
GCUAGGCAGCGGCAGUGGCGGCGGCAGCGGCGGCUGGAGCCUCUGAUUG… 6122 nt 0.4608
Summary

The protein encoded by this gene is one subunit of a trimeric complex, forming a highly conserved transcription factor that binds to CCAAT motifs in the promoter regions in a variety of genes. Subunit A associates with a tight dimer composed of the B and C subunits, resulting in a trimer that binds to DNA with high specificity and affinity. The sequence specific interactions of the complex are made by the A subunit, suggesting a role as the regulatory subunit. In addition, there is evidence of post-transcriptional regulation in this gene product, either by protein degradation or control of translation. Further regulation is represented by alternative splicing in the glutamine-rich activation domain, with clear tissue-specific preferences for the two isoforms. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that in vivo α-particle irradiation of Kupffer and endothelial liver cells induced a characteristic inflammatory state, with Nuclear transcription factor-Y α (NFYA) specifically up-regulated following Kupffer cell-specific exposure [Roudkenar et al. DOI:10.1269/jrr.07078]. A separate review noted that NFYA is part of a unique transcriptional program in immature cardiocytes entering the cell cycle after myocardial infarction in mice, suggesting a role in proliferative function during cardiac repair [Li et al. DOI:10.3389/fcvm.2022.768834].