| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCUCCGGCACAGCAGAGAGCGCUGGGAGCCGGAGGGGAGCGCAGCGAGU… | 1061 nt | 0.5476 |
This gene is a member of the NGF-beta family and encodes a secreted protein which homodimerizes and is incorporated into a larger complex. This protein has nerve growth stimulating activity and the complex is involved in the regulation of growth and the differentiation of sympathetic and certain sensory neurons. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy, type 5 (HSAN5), and dysregulation of this gene's expression is associated with allergic rhinitis. [provided by RefSeq, Jul 2008]
A study in rats demonstrated that nerve growth factor (NGF) was predicted as an upstream master regulator of neurodegeneration-associated genes at 7 days post-fracture by Ingenuity Pathway Analysis, orchestrating multimodal repair processes in neural trauma and skeletal injury [Deng et al. DOI:10.1038/s41598-025-17561-6].