Basic Information

Symbol
NGFR
RNA class
mRNA
Alias
Nerve Growth Factor Receptor TNFRSF16 P75NTR CD271 Tumor Necrosis Factor Receptor Superfamily Member 16 Low-Affinity Nerve Growth Factor Receptor P75NGFR Low-Affinity Nerve Growth Factor Receptor P75NGR Low Affinity Neurotrophin Receptor P75NTR Low-Affinity Nerve Growth Factor Receptor TNFR Superfamily, Member 16 NGF Receptor Gp80-LNGFR P75 ICD Nerve Growth Factor Receptor (TNFR Superfamily, Member 16) Low Affinity Nerve Growth Factor Receptor CD271 Antigen P75(NTR)
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_002507.4
Sequence length
3408.0 nt
GC content
0.6288

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1506.40 kcal/mol
Thermodynamic ensemble
Free energy: -1561.19 kcal/mol
Frequency: 0.0000
Diversity: 806.85
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((..((((.....))))..)))).((((((.((((((((.(..((((.((((((((((((.((.(((((.((((((...)))))).))..)))..))...))))))).((((.(((((((.(((((((...((((((..(((...((((((((.((((((((((((((((((((.((((((..(((((.(((...(((((((((((....((((........(((((.(((((((.(((....))).))).))))..)))))...((((((....(((((((((((((((((((((((......(..((.((((....(((((((.(.((((((..(((((.((.....)).)))))......(((((((...((.((((((((.((((((.((.(((((..(((((.......))))).))))).)).))).))))).))).))).))...)))))))....((((..........))))))))))).)))).(((((((.(((((.(((((((.((((((.((((.....((((........))))....((.(((..(((..(((((.....)))))...)))..))).)).....)))).)).)))).))))))).))))))))).))))))))))))..)....)))))))))).......)))))))).)))))..((((...(((.(((((((..((((((((....)))))).))..)))).)))))).....)))).((.....)).)))))).))))..))))))))))).)))...))))).)).))))))))))))))))))))((.(((......))).))...))).).))))))))..))).))))))........)))))))))))))).))))(((((((((((((.......((((((((....)))))))))))))....)).))))))...)))))........((((...((((..((.((..((((...((((((((((((((((((...((((((((..((((((((..(((((.(((.(((..(((....))))))..))).((.((.(((..(((((((((((...((..((((.((((((.(((.((((((.(((((((((((..((.((((((((((.((..(((.(((((((.(.....).))))))..).)))..))))))).))...))).))...))).))))..((((((((...))))).))).......)))).)))))).))))))))).))))...))...)))).(((..((.((((...((((((..((((((...))).)))..))))))..)))).))...)))((((.((((.....)))))))).....(((((((((....))))).))))((((((((.........))))))))((....))(((((......(((..((((((...((.((((((((((((.((((.((((...((((((.....))))))))))))))..((((((.((((((((((((((((((((..(((((((..(((..(((....(((.(..((((....))))..)))))))..)))..)).))))).......)))))))))))).)))..((((((((((.((((((((..((.((.(.((.((((.(.((((((((.((......(((((((.....(((.(((((.((((((.........))))))..))))))))........))))))).....)).))))))))...).)))).)).).)).))(((((.((..(((.((...(((.((.(((........)).).)).)))...)).))).))))))).....((((((.(((...((((((((.....(((((..(((.(.((.(((.........(((((..(((.......)))..)))))..((((((.((((.(((((...(........)...))))).)))))))))).....))).)).).)))..))))))))))))))))))))))...((......))...)))))))).....)))))..))))).((((.(((.....)))))))))))).))))))((((((.(((((((((((((((((......)))).....(((((...))))).((((((((((((((....((.((((((((((((((((.....(((((..(((((((((..((((((..((((.(.((.....)).))))).)))))).))).).))))).)))))...))))...)))).))).(((((((((..(((...((((.((((.(((.((((.((....)).)))))))((((((((.(.(((((((.(((......)))...))))......(((((((((((.......)))))))))))....(((((........))))).............................((((((((((((.((((..........))))))))))))))))))).)))))))))..(((((...))))).)))).)))).))).)))))))))..)))).).))(((((.(((((.....(((((((....))).))))..))))).)))))..))))).)))))))))((..((((....))))..))....((((.....)))).))))))))))))))))).)).....))))))))))))))......))))))...))).....)))))...)))))))..))))))).((((.......)))).)))))...)))))))).))))))))(((((.(((((..(((....)))..)))))......))))).((((((.((((((((....)))....(((((...))))))))))..)))))).....((((.(((.((((..(((((.((((...))))..)))))))))))).)))).(((((((((.((.(((......))).)).((((((((((((((((((((((...((((((.....)))).)).)))))............(((((....))).))(((.....)))((((((((((.......))).....))))))))))))))...))))))))))......))))))).))........(((((((((.....))))))))))))..)))))).......(((((....))))).)))))))))...)))).)).))..)))).)))).((((...((((...(((.((((((((.....)))))))).))).))))......))))....))))...).)))))))).))))))...(((((((...((((..((.....)).)))).)))))))......((((..((((....))))..)))).............
Thermodynamic Ensemble Prediction
.((((..((((.....))))..)))).(((((({((((((((,(((((,{{(((((((.{(((.{({,..((.((((((...)))))).))..,))..)},..))))))).||((,(((((((.((((((({,.((((((..{((,,,((({((((.{((((((((((((((((((,,((((((..(((((,(,{...(((((((((((....((((........(((((.(((((((.(((....))).))).))))..)))))...((((((.{.(((((((((((((((((.(((.{,......((((((((((..(((({((((.(.((((((,.(((((.((,...,)).)))))}.....((((((({.,((.(,((((((.((((((.((.(((((..(((((.......))))).))))).)).))).))))).))))}))}))},.,))))))....((((..........))))))))))).))))}....(((((((((..(((((((.,((((((((((((((((((........))))..(((((.((((,{((.(({.......((((((...(((,{((.((....)).))))))..))))))}))))))))))).))).)))))))}}))).)))))).))))...})))))))).)))),.}).((((..((.(((.....))).))..))))...}))))))).,.,,,,))).}))))).}}...,)})},})),..,).)))))).))))..))))))))))).,,,..,))))}.)),})))))))))))))))))))|..(({......}||{|....}}}.),)))))))}.|)}}.))))))........)))))))))))))).}}}},{,.,,((((((((((((((((((((((....))))))),..(((((...)))))......|||}|..||,,....,)}..},}))},,}})},))))}).|{{||||{|||||||{||...((((((((..((((((((..((((((((.{((,..,||,..}))}|,|,|{{{.,,.,,.|||}.{{{,((,((((...((..((((.(((((({(((.((((((.(((((((({{,,,({.((((((((((.((..(((.{((((((.(.....}.))))))..}.)))..))))))).}}...})),))..,))}.))))..((((((((...))))).))).......)))).)))))).))))))))).))))...))...)))).||,..((.((((...((((((..((((({...})).)))..))))))..)))).))(((((|((({,((((.....)))))))}.....(((((((((....)))))}})))((((((((.,,....},))))))))...{{{({{,.({{{{{{.(((..((((((..,({,((((((((((((.((((.((((...((((((.....))))))))))))))..((((({.((((((((((((((((((((..(((((((..(((..{{{....(((.{..((((....))))..,})))))..)))..))}})))).......)))))))))))).)))..((((((((((,((((((((..,({((.{,((.((((.{.((((((((.((......(((((((.....{((,(((((.((((((.........))))))..)))))))),.......))))))).....)).))))))))...,,)))}.}).).}},))((((({,{..(((.((,,.(({.((.{((........)).).)}.))).,.)).))).})))))).....((((((.(((...((((((((....,(((((..(((.(.((.(((.........(((((..(((.......)))..))))).},,,(((.,(((.{((((,..,........)},,}}))).))),,,,})).....))).)).).)))..))))))))))))))))))))))...((......))...)))))))).....)))))..))))).((({{(((.....)))))))))))).}))))),{((((.(((((((((((((..((,,.{{{{{{|{,...,(((((({{{,||,({{((({({{((({,.,,({,{{{{{(((((((((((.....(((((..(((((((((..((((((..{(((.(.((.....)).)))}|.)))))).))).).))))).)))))...))))...)))).}}}.{((((((((..(((...((({.((({.(((.((((.((....)).)))))))((((((((.(.(((((((.(((......)))...))))......(((((((((((.......)))))))))))|...(((((........))))).............................((((((((((((.((((..........))))))))))))))))))).}))))))))..(((((...))))).}))),)))}.))).))))))))}..|||}.}.|}{{(((.(((({...,.((({{{{....,)),))))..})))).))))),,))))),})))))))),,,}),))))}.))))...,.}}})))))...})}},.))))))))))))))))).}}.....)))))))))))))}.,,...))))))...},,,,...)))))}..)})))))..))))))..((((.......)))).)))))...)))))))).)))))))){({{{.{((((..(((....)))..)))),......||||}.((((((.((((((((..,,|}||...{((({...}))))}))))..)))))).,}}}{(({.((||{{{{,.|(({(,{{{|,.,))))..)))}}}}}}||}.}}}}.(((((((((.((.(((......)}}.}).((((((((((((((((((((((...((((((.....)))).)).)))))......{.....(((((....))).)),,,....,,,.((((((((({.......||}...,.))))))))))))))...))))))))))......))))))).)}........{((((((({.....))))))))}}||.}|||||}.{{(,.,{{{{{....))))},})}})}}||.{((||,{{.{{{{{{{|,.,..))).))))),)),.,,|{{.((((((((,...,)))))))).},)}))))).}}}}}}}}...})}}}...,.))))))))}))))))...(((((((...((((..(({...,)).)))).)))))))......((({.,({{{....}))}..}})).............

Transcripts

ID Sequence Length GC content
AGAGCGAGCCGAGCCGCGGCCAGCUCCGGCGGGCAGGGGGGGCGCUGGA… 3408 nt 0.6288
Summary

Nerve growth factor receptor contains an extracellular domain containing four 40-amino acid repeats with 6 cysteine residues at conserved positions followed by a serine/threonine-rich region, a single transmembrane domain, and a 155-amino acid cytoplasmic domain. The cysteine-rich region contains the nerve growth factor binding domain. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans and rats demonstrated that the NGFR is a gene involved in lipid metabolism regulation and is regulated by mechanical stress, as its expression was associated with low mechanical force signaling in bulk RNA sequencing of fibroblasts cultured on substrates of varying stiffness [Yin et al. DOI:10.1016/j.celrep.2024.114760]. In human corpus cavernosum, the NGFR was identified as a gene marker for spatial localization of fibroblasts, specifically identifying the FB6 cluster coating NEFL+ cells [Zhao et al. DOI:10.1038/s41467-022-31950-9].