| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUUUCAGGCGCUGCUGUUUUCCGGGAAGGGCAGGCGCGCUGGGCCUUGG… | 1229 nt | 0.3808 |
NMYC interactor (NMI) encodes a protein that interacts with NMYC and CMYC (two members of the oncogene Myc family), and other transcription factors containing a Zip, HLH, or HLH-Zip motif. The NMI protein also interacts with all STATs except STAT2 and augments STAT-mediated transcription in response to cytokines IL2 and IFN-gamma. The NMI mRNA has low expression levels in all human fetal and adult tissues tested except brain and has high expression in cancer cell line-myeloid leukemias. [provided by RefSeq, Jul 2008]
No relevant information is available at the moment.