Basic Information

Symbol
NOS2
RNA class
mRNA
Alias
Nitric Oxide Synthase 2 HEP-NOS INOS NOS2A NOS Nitric Oxide Synthase 2A (Inducible, Hepatocytes) Peptidyl-Cysteine S-Nitrosylase NOS2 Nitric Oxide Synthase 2, Inducible Nitric Oxide Synthase, Inducible Inducible NO Synthase Hepatocyte NOS Inducible NOS EC 1.14.13.39 Nitric Oxide Synthase, Macrophage NOS, Type II NOS Type II
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_000625.4
Sequence length
4206.0 nt
GC content
0.5609

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1583.00 kcal/mol
Thermodynamic ensemble
Free energy: -1651.96 kcal/mol
Frequency: 0.0000
Diversity: 875.27
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.......(((((.(((((.........))))).(((((.(((((....(((.........)))......))))))))))...........((((...((((((((..((((.(((..((.....))..))).((((......))))))))))))))))...))))((((((((.(((((..((((.(((((..(((..(((((((.....((((((((..(((......((.((....)).))((.((((((...(((((....))))).(((((((((.....(((.....))).....((((.(((............)))))))....((((........))))(((((...(((((((((.(((..........))).)))))).....................((.((.....)).))....(((.((((........)))).)))))).......))))).....(((((((((((((....((..(((((((((((((.(........).))))).)))....)))))..))((((.....))))..................((((....(((((((..(((....)))..)))))))))))((((((......))))))....)))))))))))))...))))))))).((((((((..(((((((..(((((((((((((...(((((((((.....))).))).)))...)))....))))......))))))..)))))))...))))))..))....)))))).))..........(((...........)))...)))..)))))))))))))))((((...(((((((((((((((((........))))))(((((.(((.((((((((..((((.(((.......))).))))..(((((((.((((((((..((((((..........))))))(((((......(.(((....(((....)))..))).)((((((((..((((.....))))..))))))))..)))))..)))))))))))))))(((..(((((((((((((.(((((........))))))))))........((((((((((((((.(.(((.........(((((((....((((((((((....(((((.((((((((((......))))))....(((((((((((((....(((.(((.((((.((((((......((((....(((((((((.(((.((((.........)))).))).)))))..))))..))))...))))))..)).))))))))..)))))))).))))).((.((((.((((((.(((((.(((((.....))))).))))))))))))))))))))).))))).(((((...(((((((((((....((((.(((...))).))))...))))))(((((((.((((((....((((.(((((.........((((((((((.(((....))).(((((((((.(((((.((..((((((((.((.....((((((((...((.(((((((.(.....(((..((((((.((((.((((..((((((........((((((((........(((((((...)))))))...((((.(((((((..((((((((((.((((....))))((((((.((...(((...)))..)).))))))...((.(((((((((.........(((((....)))))((((.(((.....))).)))))))))))))))..((.(((((.(((..(((......)))..)))...))))).))....(((((((.((((((((((...(((.((((.((((..((((.(.(.(......).).).))))..)))))))).)))..))))).....))))))))).)))..))))))....))))..)))))).).))))..(((((....)))))))))))))........(((((......)))))..))))))....)))).)))))))))).))))))))))).))..)))))))))).).)))))))..)).....((((((......)))))).(((.....))).......(((((.(((.....))).)))))((..((((.(((((.(((.((((.(((...((((.((((.(((......))).)))).)).))...))).))))((((((.((((((((((..........)))).)))))).)).)))).(((((....))))))))))))))))).)).....))))))))))))))...(((((...)))))))))))...))))...)))))...))))..((((((((((((((((((..(((((((((((.(.(((...((((.(((((((.(((.(((((((((...(((((...((((.(((.......(((((.......)))))......))))))).......((((........................))))..((((((...))))))..((((.(((((.....(((....)))....(((((((..(((((.......(((((((((((((((..(((.((((....))))....)))..))))).))))((((.((....))))))))))))((((..((((.(....((((.(((((....(((((((((.....(((.((((........)))))))..)))).)))))..))))).))))..)))))..))))...........)))))...((((((..((...))..))))))..))))))).))))).)))).)))))...))))))))))))..))))))).)))).....)))...)...))))..)))).....)))...)))))...)))))))).))))).....(((((....)))))..)))))).))))))).........)))))...))))).))))))))))......)).)))))......((((((((..(((.((((((......))..))))))).)))))).))........))).).))).)))))))))))((((...((.((((...((....((((....))))....))....)))))).)))).((((.....))))..((((.(((((((((.(((((...(((..(((((....(((.(((((.((..(((((((((.....(((((((((((((((((.(((((((((.....(((((((.((((((((.......)))))).)).))).))))(((((((((((.(((((((((....)))))))))........(((((.((((.(.....).)))))))))((((((..((((((((((..(((...)))..))))..))))))..)))...)))....)))))))).)))..((((....))))((((.(((((..((((((((((((..((.((.(((((....))))))))).))))))..(((((.(((((.((((.....((((((...)).)))))))))))))))))))))))).)))))...))))...((((.(((((((..((((...))))..))).))))..))))..)))))))))))((((.....))))((((((.(..((((......)))).).)))))).))).))))).)))))))...))))..)))))))))))).)).)....))))))))...)))))))...))))))).))))..........)))).)))).))).((((.......(((((((.(((((.(((((((((((((((((..(((...............)))...)))))))..)))..)))))))....))))).....))))))).......)))).....)))))).)).))).)))))((((.(((...((((((.....)))))))))))))............))))))))))).......)))).....)))..))))).))))..)))))....(((((((.(((...((((((((....)))))...(((((..((((((.........))))))..)))))...............((..((.....))..)))))...))).)))))))))))))))((((...((((.....)))).....))))....)))))................
Thermodynamic Ensemble Prediction
.......{((((.(((((.........))))).(((((.(((((....(((.........)))......)))))))))).{{{,....||||((((((((.,{{,...(((((((..,,......,.((((.((((......))))))}}))))))),...,...{,(((((({(((((..((((.(((((..(((..(((((((.....((((((((..(((......((.((....)).))((.((((((...(((({....))))).(((((((((.....{((,....}}}.....{(((.(((............))))))}....,,,,........,|}|(({({...{{{((((((.(((..........))).)))))).,{,...,}.,,........,((,((.....)).},.,},(((.((((.,....,.}|||,|||}}}......,)))))).,.,(((((((((((((....((..(((((((((((((,.,{{.....)}))))).})}....)))))..))|(((.....,)))..{.......,.......((((....{((((((..{{{...,)))..}}}})))))))((((((......))),))}...))))))))))))),..))))))))).{{((((((..(((((((..((((((((((,((,,.,{{{{{{((.....}}}.,}}.,)),,.,}}....))))......))))))..)))))))...))))))..}}....)))))).))..........{{(...........)))..,)))..)))))))))))))}|((({..,(((((((((({((((((........))))))(((((.(((.{{((((((..((((.(({,......))).))))..(((((((.((((((((..((((((..........))))))(((((,,......,{{....,{(|...},,..,)),}((((((((,.(({{.....}))),.))))))))..)))))..)))))))))))))))(((..(((((((((((((.(((((........))))))))))........((((((((((((((.(.(((..,{({{,..(((((((.{{{((.((((((...}|||||.||,{((((((......))))))....(((((((((((((....((,{((,{((((.((((((..,...((((,,,.,{{((((((.(((.((((.........)))).))).)))))}.)))}..)))).,.))))))..)).))))))))..)))))))).))))).,..,,,,.((((((.(((((.(((((.....))))).))))))))))).|||{{||||{,||||.,,,.,.,.{(,,{((((({.,,,((((.{((,,,|}}.}}}}...}}))))|(((((((((,..{(,...((((((((....(((({{((,(((((.(,(((,,..}}}}}))))}|,.((((....))))...)))))))(({{..((((((((..(({...((((.((({,.,||.((((((((({,((.(((....((.((((.....)))).})..,{{{{.((((((..((.(((....))).)).))))))})))((.{(({..((((((....)))))|,|||},||..((({{{|,,..,),))))),...((.(((((((((......{{{((,,,....)))))((((.(((.....))).))))))))))))))).{((.,,(((,((({{,,,..,,..}}}..)),...,))))})))...}}}((((.((((((((((.,.(((.,.(((((((..((((.(.(.(......).).).))))..)))))))).)))..))))).....)))))))))..((({.(((((..((((((.......(((((((((.((((((((((((..(((.(.{((...(((.((((((..(((((((,,((((((.(((((((.((((((((((((.,,.{(((((((((,,((.(..((((...(((.,(({{(((....{{{,,.....,}))))))|((({{.{{|||{......(((((.(((.....))).)))))((..((((.(((((.(((.((((.(((...((((.((((.(((......))).)))).)).))...))).))))((((((.((((((((((..........)))).)))))).)).)))).(((((....))))))))))))))))).}}...,,{,,,|||,.({((,((,({{((,,,||||}|,}}}}.....,,,,...,,},..,,,.}|,||},,,..,,,,,|||||,|||||.{{.({{(..,....}}.,.))}).)).}))))}}))}))))}.,))}})}..)))....))))..).))))))),,,))))).))))))|((({......})))|,...............))))))..))))))).((((({...})))))...}))))).).))).))))...)))))).)))...,,)))).)))..))))))))))}})...)))))..)))).))))))))))).))))...))).)))))))))))),}||...}}},..,..,,,....,)))..)))))})),,}}}}...(((((((((.....(((.((((........)))))))..)))).)))))..)))))))))).)))))))))|{{......}},..........((((((.{(({{{{{..,|||||{{..,,,))})),,.....}),)).))).)}).}})))}.,)))))))))))))).,,.))))))))).}})}}}.,||,,...,,,||.,,,.,{{((,(((((.(((.({(((({.(((((....)))))..,{{{||((|{{{.,{||....,))}.......,,,)}))))))),....))))).))))).))))),))))}..,,,(,((((((,{......}}..)))))).,|||({.....}}}}}..))).).)))},))))))))))((((...((.(((({..((.,,.((((....)))),,..))..}.)))))).)))).((((.....))))..((((.((((((({{,(((((,..(((..(((((....{((.(((({,((..(((((((((.....(((((((((((((((((.(((((((((.....(((((((.{{((((((.......)))))).)}.)))}})))(({((((((((.(((((((((....))))))))},.{{.{{.{((((.((((.(.....).)))))))))||||,,..((((((((((..(((...)))..))))..})))))((|,....)))..,,)))))))).})),.((((....)))){(((.((((({.((((((((((((..{(.((.(((((....)))))))}).))))))..(((((.(((((.((((.....((((({...)).))))))))))))))))))))))))})))))..,||||,..,,{{.,{(((((..((((...))))..))))))))}}),,...)))))))))))((((.....))))((((((.(..((((......)))).).)))))).))).))))),})))))).,.))))..)))))))))))).)).}....))))))))...))})))),..))))))).))))..........))))}}))).))).((((.,,....(((((((.(((((.((((((({{{(((((((..(((...............)))...)))))))..}},..)))))))....))))).....))))))).......)))).....)))))).}).))).))))){(((.(((...((((((.....)))))))))))))............})))))))))).,..,,,))))...}.)))..))))).))))..)))))((({...})))..{{,{((..(((((....))))).)))}}|{..((((((......,..))))))..}})))}})}.}.........,,,.,,.)))))))).}}}{{|{.|,...}.})))...,|,,((((,,.((((.....)))).,,,.)))).},,,}))}................

Transcripts

ID Sequence Length GC content
AUAACUUUGUAGCGAGUCGAAAACUGAGGCUCCGGCCGCAGAGAACUCA… 4206 nt 0.5609
Summary

Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. This gene encodes a nitric oxide synthase which is expressed in liver and is inducible by a combination of lipopolysaccharide and certain cytokines. Three related pseudogenes are located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that hyperoxia exposure significantly downregulated the NOS2 mRNA level, suggesting a serious risk of pulmonary collapse due to loss of lung surfactant production [Shimada et al. DOI:10.1007/S00414-008-0226-6]. In human burn patients, early decreased expression of the NOS2 gene in peripheral blood mononuclear cells correlated with burn severity, autograft failure, and infection, and its expression ratio with ARG1 significantly correlated with clinical outcomes including acute lung injury [Mahung et al. DOI:10.1097/TA.0000000000003602]. A study in human postmortem cardiac tissue demonstrated that the NOS2 mRNA expression is significantly increased in the affected regions of myocardial infarction (MI) hearts compared to healthy controls, indicating its role in oxidative stress and tissue injury [Wilmes et al. DOI:10.1007/S00414-019-02051-Y]. Further research in human MI hearts confirmed this significant upregulation and revealed a stronger, significant correlation between the NOS2 and hypoxia-inducible factor-1α (HIF-1α) mRNA specifically in affected regions, suggesting pathological transcription regulation during infarction [Wilmes et al. DOI:10.1007/S00414-020-02311-2].