Basic Information

Symbol
NOTCH1
RNA class
mRNA
Alias
Notch Receptor 1 Notch 1 TAN1 Translocation-Associated Notch Protein TAN-1 Neurogenic Locus Notch Homolog Protein 1 HN1 Notch (Drosophila) Homolog 1 (Translocation-Associated) Notch Homolog 1, Translocation-Associated (Drosophila) Notch Homolog 1, Translocation-Associated EC 3.4.21.68 EC 2.1.2.11 AOVD1 AOS5
Location (GRCh38)
9:136494433-136546048
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Cause of death analysis
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_017617.5
Sequence length
9568.0 nt
GC content
0.6348

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-4150.00 kcal/mol
Thermodynamic ensemble
Free energy: -4309.76 kcal/mol
Frequency: 0.0000
Diversity: 2207.22
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((.((((...((..(((((.(.(((((((.(((((.((((((((((((((((((((((.((.((.(((((((.((((.(..(((((((..((((((((((((((((((.((.((..(((((((((.((..((...((((((.......((((((....))))))....))))))....))..)).)))).))))).)).)))))))((.(((.(((((..(.(((.((.((((((((((((.((((.(((((.(((..(((.....))).))))))))))))))))...)))))).)).)).))))))))).))))).)).))))))....)))))..)))))))..).((((((.....))))))..........(((((...))).))..(((((.(((.(((((((((((((((((((....((((.(((.((..........((((....)))).(((.((......)).)))...(((((.(.((((....(((((((.((..((((....(((((((....)))...))))...)))).)).)))))))....))))).))).))..((((((..(((....(((((((((...(.(((((.(.(((...(((((.((....)))))))....))).).))))).)...)).)).))))).....)))...))))))......(.((((...........)))))...(((((.(((((...((......(((...)))......))))))).)))))..(((((..(((((.(((.((..((((...))))..)).))).)))))))))))).))).))))..)))))))))).)))))))))))))))))...))))..)))))))))))))))))).........((((.(........).))))...)))))))))).))))).))))))))....((((((((....)))((((...))))...........((.(((.(((((.....)))))..))))).........((((((((......(((....)))(((.......))).......(((((((.(((((.((..(((((.(............(((((((.........((((.((((((.(((((((.(((......))))).)))))..((....)).......(((((.....)))))))))))))))........)))))))...(((((.(((((.((((.(((..(((((((((((((..(((((((...(((........)))((((((((((((((((((((((.((((...(((..((((((((((((......((((...)))).......)))))))).))))((((((((...(........)...))).)))))..((((((....(((((..((((((((.(((((....(((..(((((..((((...(((...(((((....)))))(((((.((.(((..(((((((((((((((....((((((((.((((....))))..))))(((((((((((((((........))))..((((....)))).((((.(((((...((((.((((((..(..((((((...(((.......))).))))))..)..)))))).......((((((...((((((((((......))....))))).)))..(((((((((........))))))))).((((.(((..((((((.....(((((..((((...))))..)))))..((((..((((((((................(((((.....((((...))))..)))))((((((((((((((..((..((((.((.(((.(((((....((.((((.....((((..(((((..(((......))).))))).))))......)))).))..((((...(((((.((((((.(((........)))...)))))).)))))))))..(((.....)))...(((((((.(((..(((((.....(((.((((((((..((((.((((.(((((((...((((.((((.(((...((......((.(((((.(((...((((..(.(((((((..((((((((...(((....))).....(((.((((.....)))).))).(.(((.......))).).......)))))..........)))..))))))).).....)))).))).))))))).....))))))).)))))).)))))))))))))))....))))).))).)))...((((......))))..(((((((((..((((((......))))))..((((((((((.(((((((..(((.......)))...((((...))))...((((..(.(((.(((((((.((((((.......(((....)))........((((.(((......))))))).)))))))))))))...))).)..))))(((((((((((.(((((......(((.......))).......(((((..((..((.((((......((((((((.(.(((....(((.(((((((((((((((.(((((((..((((..((....))..))))..(((.(((((........(((......))).........)))))...)))(((((((((....)).))).))))(((((..((.((....))))..)))))....))))))))))))(((.((((...(((((...(((((((......((((((.......)))))).((((.((((...((.((.((..(((.((..(((.((((((.(((.(((((((((.(...).))).)))))).))).)))).))..))).)).)))..)))))))))).)))))))))))...)))))..)))))))((((((....)))))).(((((((.((((.((((.((((((((..(((((........))).))..)))..))))).(((((......))))).(((((.((((((.((((.....(((((((((((((((((((.(((....(((((((((((.......(((((.(.((((......)))).)((((.(((((.(((....((((((....((((((....((.......))....))))))...))))))..)))....(((((..(((((((.............(((......))).((((....))))..)))))))..)))))((((((((.......)))))))).(((((((((((.((.(((....(((((((((.(((((((((.((.((((((.((((((......(((((((...(((.((..((((((((.((((..((....)))))))))))))).)))))...)))))))...(((((.......))))).......)))))).)).))))))...((((((......))).)))...)))))))))........((((..((((((.(......))))))))))).(((((..............((((((.((((((.(((((((((((.(((((((.((.(((((....(((((((((..((.(((.((((((....))))))))))))))))))))..)))))..)).))))))..((((((((.(((((.......))))).......(((((........))))).)))))..))).....).)))))))).))))))).))))))))(((......((((.((..(((((((.((((((((((((.........((.((((.((((((.((((((((.................)))))))).))..)))).)))).))((((((...((((((((.......))))))))..))))))............(((((.((..((......))..))))))))))))))((((((.((......(((((........))))))).)).))))..))))).))))))).))))))...))).)))))(((((.(.(((.((((..(((.((((((((((.....((((((((((.(((((((........(((((((............((((((((((..(((((..(((.((....)).)))..))))).....)))).))))))((((((((......((((.(((.((((((....((..(((..((((((..((.(((((((((.(((......((((((((((.(........).)))).)))))).....))).)))))).)))))......((.(((...((.((((((....)))))).)))))))((((((.(((.....(((.......))).....))).)))))).((((((......)))))).((((....))))(((.(((((((...))).)))).)))...((((((.......))))))...((((....)))).......)))))))))..)))))))).)))...))))......))))))))..)))))))...(((.....)))...))))))).))).)))))))))))))))))))))))).))).).))))).....)))))))))...))).)).))))))))))).....((((.(((((.(((.(((.........))))))))))))))))).))).))))...))))).......)).)))).)))))....))).))))))...(((((((((..(.(.....).)..))).))))))..(((((.(.((......))))))))......((..(((.......)))..)).)))))))))).))).........((((.....)))).....(..((((((..((..((.((..((((........))))...)).))..))..))))))..)..))))..))))))))))).)))).)))...).)))))))..))).))))))).)))....))).).))))))))..(((((((((....(((((((..((.....)).)))))))....)))).)))))..((((...))))...)))).))))..)))))(((((((((((....((((((((((......(((((((((..(((((((.((..((((((..((.(((((((((((((.(((((.((((((..((((....))))))))))..))))).))).)))...)))))))))...))))))..))(((((..((((((((((((...))..))))..)))))).)))))...((((..........)))).....))))))).)))))))))((((((((((((((((..((.....))..))))).)))))))))))...((((((..((((((((...(((........))).)))))..)))..)))))).(((((..((((((..((((((.(((((.(((((((..(((((.(((((...)))))..)))))....((((.....))))...))))))).))))).)))...)))..))))))..))))).((..(((((((((.(((((((.....(.((((((((((...........((.(((..(((.(((.(((.(....).))).))).)))..))).)).......)))))))))).)))))))).))).....)))))).))))))))))))(..(((((.((((.(......))))))))))..)..(((.(((((.(((.(((...........))).)))))))).))).(((.(.(((((.(((......))).)))))..).)))..))))))..)))))))))).))).))))))))((.(((((((((........)).))))))).)).(((((..(((.....))).)))))...)))).))))))).).)))))((((.((((((((...((....))...((((.(((((((((....).))))..))))..)))).))).))))).)))).))))))))).................)))))..)))))))))).)))))))).))))))...))..)))..(((.(((.((....))))).)))..)))))))))))....))))))....))..)))).....((((.....))))))))))..)))..))))...))))))((((.(((....))).))))...)))).))))))))).)))))))))))......))))....)))).).))))))))))..))).))))))).(((((..(((.(((...........)))....(((.(.((((.(......).)))).).))).)))..))))))))...))))...)))))..)))...))).)).)))))))).)).))).....))))))..............(((((..((((((.(......))))))))))))((.((((....)))).))......(((.....)))((((((((.....(((((...(((........))).......(((((..(((((((((..(........)..)))).....(((((....)))))((((((.(.((.((......)).)).))))))).....(((((((((((...((..(((((((((.......))).))))))))...))))(((....)))...((((((........)))))))))))))))).))..)))))))))).))))))))...))).)))))))))))))))...((((..(((.......(((((((((((.((.......((((((..(((((.((.(((((((....))))))).))....(((.((((((((....))))....)))))))........((..(((((......)))))..)))))))..))))))......))))).)))))))).........)))))))(((.(((((((..(((....)))..))))))))))...((.(((......)))))....)))))))))))((((((((((..((((((((.........))))...((((.(((((((((((((.((.((..((((.((((((....((.((((((....((((.(((((((.((((...((((((((((.((((.((((..((((((....)))).))..))))....)))).))))))...(((.(((((((......((((..((((....))))..))))))))))).)))...))))....)))).))))))))))).((.(((((..(((((...(((((...)))))))))))))))))((((((....((........))..))))))..)))))).))..((((((....))))))....)))))))))))))))))))))...................(((.((.((((...)))).))..)))........((.((.(((.....))).)).))............(((.((((.....))))))).((((((.(((...(((((.....)))))..)))..)))))))))))).))))((.((((((.(((((.((.((((((.......)))))).))))))).....))))))...))..)))))))))...))))).)))))))..)))))))))))))...))))))))))).).)))))..).)))))..)).)))))((((((........).))))).....)))))))(((.....)))...(((((....)))))..))))))))))))).(((((.(((....)))))).))....)))).).)))))...))...(((...)))((((..((((((.......))))))..))))))))..))).((((((((((.((.(((.((.((((((...((..((((.((((..(((.((((((((((((........)))))...))).))))))).)))).))))..))...))))))..)).)))..))....((((((..(.(((((((((.....))))))))).)..))))))........(((((........)))))(((((...((((((((.......(((((((((..((((((........((((((...(((((((....)))))))..(((.((((..........)))).))))))))).......)))))).)))))))))....))))))))..)))))....((((((((((((((((((.(((((((.....)))))))...(((((((((((((.(((...........))).)))))))))))))((((...((((............))))...(((((((..((...........))..)))))))...))))....(((((((((((((.((....((((.((.((((.....)))).)).)))).....)).)))...))).......)))))))(((.(((((.(((((.....((..((((((....((((((((.....(((((((((((...........))))))))))).....))))))))..)).))))..)).....)))))...))))).)))..(((((.(........).)))))..)))))))))))))))))).....((((((((((...(((((..((((((((.(((((.(((((((((((((((..((..(((((((.(.(((((.((.((((.(((((.......))))).)))).........(((((((((..(((....)))..)))).)))))((((.((((.........(((((((...(((((((..((((((((....((((..(....)..))))))))))))..))))))))))))))..........)))))))).....(((((((((.((((..((((((((((((((........)))).))))))(((((....)))))......)))).)))).))..).))))))....((((.((((((((......((......)).)))))))))))))).))))).).)))))))..))..)))))))))((((((((((.((((((((((...(((((((...))))))).((((....))))...(((......(((.(((.(((((.......)))))..))).)))......)))(((((((......)))))))........(((((((.(((.(.((((....)))).).))).))))))))))))))...))).)))))...)))))......(((((((.((.((((((((((((.....)))).......))))((..((((((......))))))..)))))).))..)))))))((.((((......)))).))))))))(((.((((..((((.(((((....))))).)))).)))).)))((((((((........((.(((((((........))))))).))...))))))))......)))))))))))))..)))))....)))))))))).))))))))))......
Thermodynamic Ensemble Prediction
....{,((...,|}.(((((.(.((((((,{(((((.(((((((((((((((((((((({((.(,{(((((((.((((.(..(((((((..((((((((((((((((({,((.({,,(((((((((.((..((...((((((....{..((((({....}))))).,,.))))))....))..)).)))).))))).)),)))))))(,{(((.(((((.((.(((.({,((((((((((((.((((.(((({.((({.(((.....))).))))))))))))))))...))))))))).))}.)).))))).))))).)).))))))....)))))..)))))))..).((((((.....))))))..{{{,...,{{((,...|||{|({.(((((,(((,{(({((((({(({{,{{||{||}||{|}||||||.,,||..,||||||,...|||,.(((.((......)).)))...||||}||,|||||..,((((.,(((.((((.....)))))))..))))|{{{,((({{{{{..,|||{|{{{,,,.{{{{{.,,||||.||..{(((({..{{{....(((((((({..{({(((((.{.(({.,.(((((.((....)))))))...,))).).))))).)},,}},)).))))).....})),,.))})|},,..,,(,((((...........))))....(((((.((((({,,({......||||..}}}......}}})))).)}}}}..{{{....,|||....,.|)),))}}}).))))}..})).).))))))))))}))))).,,})}))))))},))).}}})))}},,}}})))}}}}))))..)))))))))))))))))).........((((,(......,.).))))...)))))))))).))))).))))))))....{(((((((,,,,|.|{{{(,,,|||||,.,,......{(.(((.(((((.....)))))..)))))|,..,..{,(((((({,......(((....)))(((.......))).......(((((((.(((,({((.{((((,,.............||}}|||.}}}}}}).((((.((((((.(((((((.(({......})))).)))))..((....))......,(((((.....)))))))))))))))..{{{{..,)))),,...{((((.{((((.(((,,(((.{(((((((((((((..(((((((...((,.......,))}((((((((((((((((((((((.((((.,,(((.,({(({(((((((.,...,(,{(,,,,|||,,.....||}}||||,|}}},{||||||..,|.....,,,),.,))).}}}}}..((({{{....{((((..((((((((.(((((.{..(((..(((((..((((...(((...(((((....)))))((({((((.(((..(((((((((({((((....((((((((.((((....))))..)))}(((((((((((..((({.....(((((((((((....)))).))))))).}}}}(((((.....)))))...(((({{(.(((.({{{{{{,.({{{{{|.|{..|||{{|......,|,{{{{,,.(((((((({(..,,{{|,....|||||.|||..{((((((((........))))))))),||{|.((({.{(((,,....}||||{|,(((({..,,|{{.,,,,...|||,}}||||||||,....,,..,..}.}||||{|}|,|,{{{{...)))}}})||||{{({{,{{||||||}.{,.,{||{,{{.((((({{(({{{.{(,((((.....((((..(((((..(((......))).))))).)))).,}.,.)))).)).,((({...(((((.((((((.(((,.......)))...)))))).))))),,))}}((,.,,..{(((((((({{(({.(((.,,}}}.....(((.((((((((..((((.((((.(((((((.,.((((.((((.(((...{{..,,,.((.(((((.(((.,,(({({,{.{((((((..((((((({..,(((....}}|,....(((.((((.....)))).))).,.{||,......,)),).,.....,})))....}}}.}.)))..))))))),)...,}))),.))).)))))))...},),))))).)))))),)))))))))))))))....))))).))).)))...((((......)))).,{{{(((((...((((((......))))))..)))))}.((.((((((({.,(((.......)))|..((((...))))..,(((.((({(({{.{(((,...,}))}}.....,{((....))}.,{{{{|,,,,},})))|{.((((((..(((((((..((((((((.((((..((((((((..(((((((.{.(.((({..(((........,.}}}.)).)).).}.))),,)))..).))),,)))..)))){{....,}...,,..(((((((.(((((.(((((((...,.(((((..(((((((..{,,{(,.{,(((..,{{{..,,,.}}}}.,)),........}}|||.{{|.,(((((((({....}).)))}}))).))).,.}}))..))))}}))..))))).).))))))))))))(((.((((...(((((...(((((((......((((((.......)))))).((((.((((...((.((.((..(((.((..(((.,(((((.(((.(((((((((.(...}.))).)))))).))).))))},,..))).)).)))..)))))))))).)))))))))))...)))))..)))))))(((((...)))))))))))).,.(((((((...,((.({(((....)))....}....}),,)....)))))))...(((((......))))).(((((.((((((.((((.,,..((({(({((((((({((((.(((,,..((((((((({{,.,,..,(((((,{,{{{{....,,}}))||({((.(((((.(((,,..((((((.,..((((((....((.......))....))))))..,)))))),,})}....(((((..(((((((,.{,.......,{(((......})).|,||....)}))).)))))))..)))))((((((((......,}))))))).(((((((((((.((.(((..,.(((((((((.(((((((((.({.((((((.(((((,.,....(((((((...(((.((..((((((((.((({.,((....)))))))))))))).)))))...)))))))...(((((.......)))))......})))))).)).))))}}..,((((((......})).)))...)))))))))...,.{..((((..((((((.(.....,})))))))))).((((((..{((((((,.,(((((((.((((((.(((((((((((.(((((((.((.(((((.,..(((((((((..((.(({,((((((....)))))))))))))))))))).,)))))..)).))))))..((((((({.(((((.......))))),||.,|{(((((.,....,.))))),})}})}}))).....).)))))))).))))))).))))))))|,,....,.,))|,))}.,.)))))),,,,((((((((.,,,.,,..((.((((.((((,(.((((({{{,.....,,,........)))))))).},,.)))).)))).)}((((((...((((((((.,....,))))))))..)))))).{{,.,,,.,.,{{{{(.((..{,......,}..},})))})))))))|{{{{(,((,.....(((((........)))))}),}).)),|{.((({{((((|,.,.}}}))}}}))))}))}))(((((.(.(((.((((..(((.((((((((((.....((((((((((.(((((((,{..{{,,(((((((.,,,....,,..((((((((((..(((((..(((.((....)).)))..))))).....)))),})))))((((((((......((((.(((.((((((,,..,{..(((..{(((((..((.(((((((((.(((......((((((((({.(,.......),)})),)))))).....))).)))))).)))})......((.(({...((.((((((....)))))).))}})))|(((((.(({.....(((.......))).....))).)))))).((((((......)))))).{{{{,...||}}(((.(((((((...)))},))).)))...{{{{{{.......)))))).,,||||,,,.))},...,,}.)))))))))..,})))))).)))...))))......))))))))..)}))))}...{{|,....)}),.,))))))).))),}))))))))))))))))))))))).))).).)))))}}),}))))))))).,.))).)).)))))))))))....,|||{|(((((,((({(((.........}}|})))))})|}}}}|,|}}.}))))},))))}.,..,..,}.,))),)))))..,.))).)))))},.{((((((((({..{({{..,|{{,.|||,}))))}|.(((((.(,{{......)),)))))......{{..(((.....,,)))..}}.)))))))))).))},........||||..,},))))}}}}.|,.{{{({{..{{..{{.|{,,|||{.....,},)))).,,)),)),,)},,}})))}..,,,))))..))))))))))).)))))))).)))))))....)))))).}},)))))}}))}))).))))))))))((((.(((((.....))))).}}})}...})))))))))))).,}.,))))))))))))),..,})}))},.,...)),))))))).,(((({((((({..,,{(((((((((.,{,((((((((((.((..((((({((..((((((..((.(((((((({((((.(((((.((((((..((((....))))))))))..))))).))}.)}),.,)))))))))...))))))..))(((((.(({...,(((({{...}}..)))){(((((((((.((((.,,,((((.(((,{,.{{....},}}}),)))..))))..((((((((((((((((((,,({...,}))..))))),})))))))))).)),,{,(((.((.(((((...(((........))).))))).)).))}})}})))).))))))))))}}}||||({(({.{{((({{..,.,}},,)}}|})))})))))).})))))..)).))))))))))|}|({{{,(((((((((,({.((....)).)))))))))))..)),))(((((((((.(((((((.....{.((((((((((..,{.......,|.(((..(((.(((.(((.(....).))).))).)))..))).}}.......)))))))))).}))))))).))).....)))))).,|)))))))))}{,.(((((.((({,(......))))))))))..}..(((.((((,,(((.(((..{.....,..))).)))))))).))).(((,,.(((((.(((......))).))))).,},)}}..))))))..})))),.{{{.((......})))).,)}}|}}},}}}}}}}}}{(((|....,)))),((((.(((.{((({{...,{||.{{{.(({((((.(.((((((((((((((((((((....((({.,.{{({.((((.(((((((((....)}})))..))))..)))).}}.....(((((((((.(((|.....,,}.,,,...(({.(((((....))))))))..))))}}))))||,......||.{((..(((.((,,((....))))).)))))),)).}.))))....)))},........,)))))).)))))))))).).))){(((((....))))))...{|,,,,..}}.)))).))).,}))....))))))))).))))..))))))))))).....,))))....)))).}.))))))))))..))).))))))).{((((..({(,(((...........))).},.(((.{.((((.(......).)))).).))).,}}..))))))))...))))...)))))..)))..}))).)).)))))))).)).))).....)}))))},..,,......,,|||{..,((((((.(......))))))))||||((.((((....)))).))},.,,.{{{,,,..}}|((((((((.....,((((...(((........))).......(((((..{((((((((..(........)..)))).,{{.(((((....)))))((((((.(.((.((......)).)).))))))).,},.(((((((((((...((.,(((((((((.......})).))))))))...))))(((....)))...((((((........))))))))))))))))}.}..)))))))))).)))))))),..))).)))))))))))))))..(((((....).))))..((((((((((,{((.......((((((..(((((.((.(((((((....))))))).))....{{{{((((((((....))))}...})))))}.....,.,|{..(((((......))))).}),)))))..))))))..}...))))).))))))))......{{{{...,.,(((.(((((((..(((....)))..)))))))))),..,|})|{{{,...)))})....))))))))))|(((({((((({.((((((({...,,{{{.||},..,|{,|}|||{,,{{((,(({((((({{,(((((,{{{(....{{.(((((({...((((.(((((((.((((...,{{,{(((((,((((.((((..((((((....)))).))..)))),,,.)))),||}|||.{.(((.(((((((......{(((..((((....))))..))))))))))).)))..,)))),...)))).))))))))))).{{.{(({.{((({(({..(((((...}},||,|||||||}}||(({(((,..,{,....,}.},,..)))))){{(({{{{.....((((((....))))))....)))),)))).})),}||))|||.||,.,............||{.{{.({{{...)))).))..)),........||,||}|},,.)}}))),)),))),)))}}.....{{{.((((,....||||}|}.||,,,},.))))),)))}}}..||||{|{.{{{{{|{|.|,|}|||||}}}}{{.((((({.(((({,((.((((((.......)))))).))))))).....)))))).,}))..)))}))))),.,})))}.)))))))..))))))))))))),}.))))))))))).).)))))..,,,)))),}))}))))){{{{||......,,)))))))}....,,,,,,,(((.....))).,,|||||.,{,|}}}}..,}}))))))))))|({(((.(((....)))))).))....)))).).)))))........{.,...|.(((((..((((((.......))))))..))))),.,,.}}..((((((((((.{(.{((.((.((((((...((..((((.((((..(((.((((((((((((........)))))...))).))))))).)))).))))..))...))))))..)).)}),,}}....((((((..(.(((((((((.....))))))))).)..))))))........(((((........))))){((((...((((((((.......(((((((((,.((((((........((((((...(((((((....}))))))..(((.(((,.,,......,)))).))))))))).......)))))),)))))))))....))))))))..})))),...((((((((((((((((((......,((((({{,.,....,.(((((((((((((.(((...........))).))))))))))))),|||,..((((............))))...(((((((..((,...,,,....,,..)))))))...........(((((((...(((,((,,..{|||.{{.{{((,,,..}}||,},.}}}}..,}},.,))),...)),)))...))))))){{{.{((({.,,,(({{{..,,..{,||||,...,,||||,{..}},{((((((((((...........))))))))))),},}}))}|||||{{.|{||||{{|.{{,..,,,,)}}.)})))})))}.})}}}}}}||||,,...,)))),.)))))))))))))))))).....((((((((((...(((((..((((((((.((({(((({{((....,}|})}}|,..,(((((({({((((((.,{{{{,.{((({{{,,,,.}}|}|,}}},,,,}}....(((((((((..(((....)))..)))).)))))(({{(((((.,...,,,,(((((((...(((((((..{(((((((....((((.,,....,.,)))))))))))}..))))))))))))))....,,,}..))))))||,{{......|||}}}(((({((((((((((.........)))))))))).(((.((((((((((...)))),,))))))))(((((......)))))...((((.((((((((......((......,}.))))))))))))..)))))..,.)),)))))))))})))),|||.(((,((((((.((((((((((...(((((((...))))))).((((....})))..,(((......(((.(((.(((((.......)))))..))).)))......))){((((((......))))))}........{((((((.(((.(.((((....)))).).))).))))))))))))))...))).))))),.})),))}..{{,((.(((((((...,(((,((((({.{{{|,,,.......||||||..((((((......))))))..},|,}|})}|..,,.}))),)))))}..}})..))))))).)).|||.{{,{..((((.(((((....))))).)))).}}}}.}|}{{((((((....{{{{((,(((((((........))))))).|}.,,}))))..,.))}}}}))))))))))))..)))))....)))))))))).))))))))))......

Transcripts

ID Sequence Length GC content
NM_017617.5 NCBI
ACUAGUGCCUCGGCCGCGGGAGGGAGCGCAAGGGCGCGGGGCGCGGGGC… 9568 nt 0.6348
Summary

This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor plays a role in the development of numerous cell and tissue types. Mutations in this gene are associated with aortic valve disease, Adams-Oliver syndrome, T-cell acute lymphoblastic leukemia, chronic lymphocytic leukemia, and head and neck squamous cell carcinoma. [provided by RefSeq, Jan 2016] CIViC Summary for NOTCH1 Gene NOTCH1 is one of four known genes encoding the NOTCH family of proteins, a group of receptors involved in the Notch signaling pathway. NOTCH proteins are characterized by N-terminal EGF-like repeats followed by LNR domains which form a complex with ligands to prevent signaling. The Notch signaling pathway is involved in processes related to cell fate specification, differentiation, proliferation, and survival. Activation of Notch has been shown to be correlative with mammary tumorgenesis in mice and increased expression of Notch receptors has been observed in a variety of cancer types including cervical, colon, head and neck, lung, renal, pancreatic, leukemia, and breast cancer. A number of treatment modalities have been explored related to Notch inhibition especially in breast cancer with mixed results.

Forensic Context

A study in human cardiac tissue demonstrated that HN1 mRNA was downregulated in the mechanical asphyxia group compared to the craniocerebral injury group, identifying it as a potential biomarker for mechanical asphyxia-induced death [Zeng et al. DOI:10.1007/S00414-017-1616-4].