Basic Information

Symbol
NOTCH4
RNA class
mRNA
Alias
Notch Receptor 4 Notch 4 INT3 Neurogenic Locus Notch Homolog Protein 4 Notch (Drosophila) Homolog 4 Notch Homolog 4 (Drosophila) Notch Homolog 4 HNotch4
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_004557.4
Sequence length
6745.0 nt
GC content
0.6169

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2938.60 kcal/mol
Thermodynamic ensemble
Free energy: -3048.52 kcal/mol
Frequency: 0.0000
Diversity: 2175.86
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
........((((((...))))))..((..(((((..(((((((((((....((((((((((..((.(.((((((((.(((.(((..((((((((((((.....))).))))))))((((...((((((((((((((.....)))).)))))))...((.((.((.((....)).)).)).))(((...(.((((((((((((((.((...((((......(.(((((...))))).).))))(((((......)))))...((((.(((((((((((((((..(((.((((((.((((....(((((.....(((((((((......)))))...))))..))))).))))(((((.(((((....(((((((((..(((((((...))))...((((((..((((((.(((((.((.((((((((.((((.((((.((((((.((((.((((....((((((.((.((....)).)).)))))).))))........(((...(((((((.....((........))(((((((((((((((((((((((((((((.((((..(.((..((((.((((((......)))))).)))).)))((((.((((..(((((..((((........(((....(((((((((((((......)))))))))....))))....))).((((...))))...(((((((((((((..((..(((..((((...(((.....((((((((((((...((((.....))))..)))))............((((......(((.((((((((((...)))((((((((((((....((((.(((((((((((....)))))).....((((((.((((((..((((((..((.(((.(((.(((.........(((((((((.((((.((((((.(((...((((((......((((((..(((..(((((..((((((((.(((.((.....)))))))))....))))..)))))..)))..))))))((((((.....((.((((..(.((((....)))).))))).)).(((..((((......))))..)))((((((((...))))....)))).((((....(((((((...((((((.....(.((((((......((((((((.((((.(((((.(((((((..((..((((((((.(....(((.((.((((((((..((..(((((((..((((.....))))......((((((((((................))))))))))..)))))))..(((((((.(((((((.((((....))))...))))..))).)))))))..)).)))))))))))))...)))))))))..(((((.(((((....((.((((.(((((.((((((((......))).)).(((..(((.((((((...(((((((......))))...)))...(((.(((.(((((((...(((...........)))......)))))))..))).)))..((((....((((.(.((((((((......)))))))).).)))).....))))...(((..((((.....))))..)))...)))))))))...))).(((.(.(((((((((((((.....((((.((((((((.((((.(.(..(((...(((((..(((((.....).))))..)))))...))).).).))))(((((.((((((((..((((((.(..((((.(((...)))))))..))))))).)))))...))).))))))))).))))..))))..)))..)))))))))).).)))....(((((((((((((.......))).).)).)))))))..))).))))).)))).))..)))))))))).((((.(((((((......(((((.((((.((((.(((((((((....(((((((((.....((((((((.((..(((((((..((((((..((((......))))..)))))).........(((((.((((((((.(((.((((((.(((((((..(.((((((((.....)))).)))).)..))).....(((((.((((((......(((.........)))........)))))).)))))...)))).)))))).)))....)))))))))))))))))))).))))))))))))).((((((((....(((((((((((.((((((((((((........)))))((((....)))).........((((.....)))).((((((((((((.((((.(((((.(((.......))).)))))))))(((((......)))))(((...((((....(((((.....)))))....))))...))).....((.(((((((.....((((((.......))))))....))))))).))...((((......)))))))).)))))))).(((((...((((........)))))))))..)))))))...))))......((((.(..(((....)))..).)))).)))))))))))))))((((((((((((....((((.(((((((((.((((((((.(.((((((((((((.....)))......))))))))).)...)))))))).))......(((..(((.....)))..)))(((........)))...((((..(((((((((.(((.(((..........)))))).)))..)))))).))))..........)))))))...).)))..((((......))))..((((.((...........)).)))).....((.((((.((((....)))).)))))))))))))))))).........))))))...)))))))))(((.(((.((((((((((....))))))).))).))).....)))...((((((((..(((..(((((......))))).....)))..))).))))).)))).))))))))).....))))..))).))))((((((((((.(((....(((..(((((...........((((((((((((((((((((................)))))))).)))).)))).)))).)))))))).)))...))))))))))))..)).))))))))))..)))).)))).)))).)))))))..))))))...)))))))..))))..))))))))))))..))).))).))).)))).)))))))))......((((.(((.(((.......)))....)))))))..(((((....)))))((((......))))))).))).))).)).))))))......))))))))))))....)))))))))))))))..))))))(((..........)))....)))))))))).....))))..(((..((((((((....(((......)))...)))....)))))..)))))))))))))...))))..)))....))....)))).)))))))))........((((........))))))))..))))).)).)))))))))).)))))......((..((((.(((((((((((...((((..(((.((((.((.....)))))).)))..))))))))))))))).))))..)).)))))))).)))).))))...)))))))))))))))....)))...((((((.((((((((((((.(((((.....((((((((((..(((....((......))....)))..))))))))))((((...(((((((..((((....((((....))))..))))..).)))).))..))))(((...((((((((.....((.((((((...((((((.(((((((((((.(((((.....(((((..........((((((.(((((....)))))(((((((..((.((((((((((((((....((.(((..((((...))))..)))))...)).))))).)))..))))...)).)))))))........))))))...)))))..((((((((.(((.((((.......))))))).)).))))))..)))))))))...)))))))..)).))))...((((......))))...)))))).))....))).)))))..))))))))))).(((...))))))))))))))))))((((.((((..(((((...((((.....))))))))).)))).))))..((((((((.((((((((.......))))....))))))))))))(((..(((((.......)))))..)))(((..(((((((((((((((((((.((((((((((((((...((..(((((....))).)).)).))))))).)))))))))((((.....)))).((((.((((((((((.((((((..((((((((((.((((((.(((.((.((((((((......)))))))))).)))))............(((((((...(((((....))))).)))).)))(((((((.((((((((((.(((.....((.(((((..(((.((((((((((((((((......(.(((((((((.....(((((.(((((.(((((((.(((.((((.((((....((.((.((.((....)).)).)).)).)).))))))))).))))(((((((.(..((((((((.(..........).))))))))(((((((.((((((((........))))..)))))))))))).))))))).....))))))))...)))))((((((..((.....((((((..((((..(((.((.(((((((((((((((((((...)))))....)))))..))))))...)))...)).)))..))))..)))))).(((((((.......)))))))))..))))))....((((((((.((.(((((..(.(((((((((((((...)))))).))))))).)..))))).)))).((((((.((.((((..((((((.((((((((.((((((((...)))))(((........)))..((((((..(((((((.(((((.(((..(........)..))))).)))..)))))))((((((((((((..((((((....))))))....)))..)))))).)))(((..((((..(......)..))))..)))))))))...))).))))))))......)))))).)))).))...))))))..)))))).))))))))).).......))))))........)))).)))))))))..))))))).....)))....(((((.((((.((((((..(((....)))........(((((..(....)..)).)))..((((((((....)))))))).)))))))))))))))....((((((((....))).))))))))))))))).))))))))))).).)))))))))..)))(((.(((((((..((((.....(((..((((.(((.((((((..(((.((.(((((((((((((((......))))).......))))..(((.((((....)))).))))))))).)))))....(((((((((....(((((((((((....))))))..(((...))))))))....)))))))))......)))))))))..))))..))))))).))))))).))).(((((...)))))......))).)).))))))))))))..(((((((((...((....)).....))))))))).(((((.(..((.((((.(((.(((((((((((.....)))).))).)))).)))..)))).))..))))))......)))))))))...))))))))..)))..)))))))))).)))).)))).))).))..))....).))))))).))))))))))))....))).)))))))))..............((((((((((...(((((....))))).(((((((((.(((...)))..)))))))))..((((((.......(.(((.........)).).)))))))...................)))))))))).........((((......))))....))))))))))((((((.....))))))...........(((........)))....(((........)))(((((..((.....((.((((.(((((((.(.((.((((........)))).))).))))))).....)))).))..))..)))))...))))))))).))).....)))))......)))))))..)))).((((((.(.((((((((.((((((((...(((((((((............((((((((...((((...)))))))))))).))).)))))))))).)....)))..)))))..))).).))))))......))))))).........((.(((((((((...((((...))))...))))))))).))..((((((...))))))...)))))).))).)...))).)))..))))......)..))).)))))))).))).).))..))))))))))..)))))))................))))...))).))..))....(((.(((.......))).)))
Thermodynamic Ensemble Prediction
....((((((({,{{{(||((|,((((,({((((((.{((((((((({,,.{(((((({(((,,..,{{{{|((,(,((((,..{,((((((((((((.....))}.)))))))|(((((((((.(((((((((((.....))))))))))))...((.((.((.((....)).)).)).)).||,..(((((((((.(((((({(((((((((.,....{.(((((...))))).,.)))),.((({..((.(((({,,{,{{{.{(,,(((({{.,,,|.}))|}}..}|})).)))))))))))...))))))(((((......))))))))))).)))..)),,))).{|||.(((((.....,,.))}))}}})))))))))}},)},,}}))}})),)))|,.,}}}|)})}}|}}||}}}}}}...}}}.,}}}}}|,,{{.|||||||{{{{|||,||}|{{{,{|},||,}}||||{{.,{((({,(({({{,{{(({..{{(((((({({{{{....(((((,.,,{.,.(((((((((.,((((.{((.....)}),.)))).}.))))))))),,{,((((.((((((.,{(((,,,(({.,((({..,,,,....((((......)))).(((((((((......)))))))))}}}}}}},|||||}}}||,|}}}}|||{{.{((((({.{(({{(,{{{(((.......}}}{{{{{|||||||...,{||.,|||((((({..((({.....}|||....,{,,,{((((,{,,,,....,{{{{,||||..,})))))))}||{((({,{{(||(((({{,{((((({.,{||({{{{..,,}))||,{{||.,,,{|||{{|,|||}}.||.{,.|||{({({{{{.,,,...|}}}|,,,|||||{||{({{{{.{{(((.{{,,,{{{{{{.,{((,||((({..{{((({{,.{{|,{|....)))))))))).,..||||{{|||||{{}}|{,,|||||{|.,|,,.......|||,.,|.((((....)))).|||||{||},|{|}||.,..},,||||}||||{|.|||.}}||||||{((({((,,.,,,}}...})))},.}|||((((.......)}))}}|{||||,|||.|.{||,||,||.||{|||||,|||||.,||||{{{|{,|..,,|||,{|.|||{{{||,,{{,,|||||||,,|(({{{{{,|||,....{,((((({((((.,,,,{.,,,|,,...}}}}}}}}))..(((((((...))))))),.,{(((.((((....)))),,,||}||,|||.||||||||||},}}}}))})))}}}...,}}}}}|||||}.........|||||||{.{{({||{,.....,(((((...{{({{{.{{{{{{{(,,.,.}}.))))}.}))}..,}...))))}..}}}}},|||.,||,|||{|||,,,{{{,,..,|{{,..|||....,,|,|||||,,}||,||||,||||,}},||||.{.((((((((......)))))))).)}))),.,}}}))))}}}|||},||||},,},))}}}})))...,,}}}}}},|||||,.|{({,.(((((((((((((.,{{.{(((.((((((((.((((.(.{..{{{...(((((..(((((.....),})))..))))),,.}}},}.}.})))(((((.((((((((..{(((((.{..((((.(((...}))))))..,)))))).)))))...))).))))))))),,))).,)))),.)))..)))))))))).),))),.},||||||{||||||,|...},}))}).)}))))}})},.}},})}}}},.||||...))))))))))},)}),)},,}}}}|||.,,,}})}}|||{||||||||,{(({{(,.,,,,||||,||{.....,{(((((.{{..{{(((((..((((((,,{{({{,,,}}}}},..}}}|}|.|,,.....{((((.((((((({.(((.((((((.(((((((..{.((((((((.....)))).)))).}..))).....(((((.((((((....,{{((.,.......,,),}}.....)))))).))))).,.)))).)))))).)))....)))))))))))))))))))),}})))))}}((((((((((((,,,.....((((...))))...,{((((.........)))))))))))))))))....,,},.|}}|}}}..,,))}|,}}|||||}||.((((.(((((.(((.......))).)))))))))(((((......)))))||{}}}|)|...,,|||,|}}||}))),}}}.,.}}}...)))}}}.}||}|,{{|||}}}},|(((((.......)))))|{{..,,,,}})})|,((((((......)))))),,.(((((....))))){{{{{{((.....,,,,,,,..||}}}}.||((({{{{(((((((.((.{((((({.,.((((((((((..((((((({.|,({{(((((....})))))}..,||||,||{,{{{{({((((((((.(.((((((((((((.....)))......))))))))).)...)))))))).)).|....||((((((....((((.((.((((.(((.,.((((((((((...(((((((((.(((.(((,....,....}))))).)))..)))))).........(((((((((((((((((({{{{,((((......))))..((((.{(..,......,.}}.)))).....((,((((.((((....)))).))))}}}}}...}}}}}...((((,.(((((...(((..(((({{,,{.({{.((((((((((....))))))),})).||||{{||,....,,((((|.....{{{|||,|{(((({{((((((..(((((((.((((((...))).))}.))).))))..))))),.,{{...({,(((,((((({(,,....,,|}}.,|||,.}}}.}}.,,|(((((((((((((((((((................)))))))).)))).)))).)))}|||||}||}.},},,|},}}}}}})),}},}|{{||,||,,.||||||||((,.,{{{||||}{,,.(((((((((...{{{{((((((((((((,{(((((((,.,...}}}}}|}}{((,({((({(((...((((((((((.(((((....((((.(......).))))..))))).(((((((((((.({.......((({......{(((.((((((((((((,.,,,.((((((((.((((((,{.((((((({({{|||(.{((......{{,.||,.....(((((((((.(,,{{........,,||||||||}}}}......}}.}})...|||.,}}.}}|,..}||||||}}|.,}}}..},,,||,{.{{{,.|.{{((,(((,((((((({...{{,.((((........)))).,,.....,)).,,,,))),.,))))))))))),)))),)..}||.(((((((((((.,,(({{..(((.((((.((.....)))))).)))..)))}))))))))))).,)))))).)))))))),||,.{{.(((.(({(((({(((((((((..,(({(...((((((.((((((((((((.(((((.....((((((((((..(((....((......)).}..)))..))))))))))((((...((((((,..((((....((((....))))..))))..).)))).})..))))(((...((((((((.{...((.((((((...((((((.(((((((((((.(((((.....(((((.......{..((((((.(((((....)))))(((((((..({.((({((((((((((....((.(((..((({...})))..)))))...))})}))).))).,})))...)).)))))))........)))))).}})))))..((((((((.(((.((((.......))))))).)).))))))..)))))))))}..,))))))..)).))))...((((......))))...)))))).))...,))).)))))..))))))))))).(((...)))))))))))))))))),{{|.|||{..{((((,..((((.....))))|||||.|||},|}},{.((((((((.((((((((.......))))....))))))))))))}((((((((((((((((({(((....((((((((((((.(,{((({.{..((,{(((((((.{.((((((((((.((((.(((((.,..((((((..(((((({{((((.((((((((((((........))))))....((((((((((((((.(((((((.(((((.(((((((((((......}))))))|{,.(((((,.....,(,,(((((((((.,.(((((....))))),)))).)))))..,.{,||{{|,}||,.||{,{{....}},|||},,||...}}}}}}}.......,})),)}})}}},}}))).)).))).))))))).))))....(((......)))..)))..))))))))))))).)))|,{,.,,....}}})}.,((((....))))...(((((((((((.(..,.......).))))))))}))),},.))))))..))))))..,))))).)))).))))),,})))).}..))))))))))............))))}.}.))).)))))))))..,.(((((((.(((((.,...,.)))))(({.,.{(((,...,.(((({...}))))}))))..,)}).)))))))...}))).})))))}.}),}))))))))}}.|||.,,}}}....,,.(((((.((.(((((..(.(((((((((((((...)))))).))))))).)..))))).)).))))),,)))).)))))))))}},.),)),))}.)))}}.|))))).((((((............)))))).....))))))))))...}}))....)).)))))))))))((....)).)))).))))))))},))}|.}},}},..||||,....)))).,|||,.||{.{{{..|||{..(,,....).,))))..})).))),,)))})))))))))))})).,{{({{{,.,,..|||...,|||((((.{|||.|||||,))))))))}....))),),....}})})})))}}))))))),.}}}|}}.....,)},|((((.....))))|||||.,,.}},.}},)},......,.}))),.))}...))))).))))..(((((((....)))))))))))),,))).)))))))))..,((((((....)))))),))))))))))...).))}.))))))..})))))))))..,,((({(((({((,,(({{.....(((..{{((,(({.(((((({.{((,((.((((((((((,((((....,.|||||{.,.....,,,..|,|}||||.,..)))).))))))))).))}|},.{|({((((({{,||.{((|(((((((....)))))),.{|{..,))})))))}},,},)))))}),}}},.})))))))),.))))},))))))),))})})),})}|(((((...))))).}}.|}}}|}})))))),)))))))))).,.})))))}.))))).))),}}.)))})).))})))))))))))||||,},|||((({||(({(({,,..}}|||}}}.}))),||||,}.}))))...||||||....}))))))..,,,,,(|{|||||||,}||||||||||||||||{{|||.,||,,}},,})}}}})}},,,|||||||||||||||{{||{|||,|||,}||||||,{{,{{.,,.,,(((((({(((,..(((((....))))).(((((((((.(({...}))..))))))))),,((((({{......,,{{{.....,,..}}.)).)}))))...................}}}}|||}||..,||||..,{{{.....,}}}}...|||}|||,,}},,))))}.))))})},,.,}.)))}}}}|||.....},}))),.,.(((({((((((((((,{......{.{(((.(((.{....|.))}.})))|.,......)))))))))).}))))}))}..}}))))}}..,},}}),)),.}}))))))},}.}})))}}}}|,,.........,,}|||,.}}},||||{|,{,|||||((,.,,,{{{{,..,|||||{{{{,,,,,,,,,,,}((((((((...((({...)))))))))))).|||,,}}}|}||||.,.,,}),),.}))))..}}},},)))))).,...})))},,,...,,,,,.{(.(((((((((...((((...))))...))))))))).)}..((((((...)))))).}}})}))}.},}.))}})),,},},|||||,{{{,.........,,,..))})))),.}.,|||||||,,,||||}}}}}}},,,,,......||...,}}..})}}.}},,,.........|||,....,,)))})).

Transcripts

ID Sequence Length GC content
AGACGUGAGGCUUGCAGCAGGCCGAGGAGGAAGAAGAGGGGCAGUGGGA… 6745 nt 0.6169
Summary

This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor may play a role in vascular, renal and hepatic development. Mutations in this gene may be associated with schizophrenia. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]

Forensic Context

No relevant information is available at the moment.