Basic Information

Symbol
NPPA
RNA class
mRNA
Alias
Natriuretic Peptide A ANP PND Atrial Natriuretic Peptide Prohormone Atrial Natriuretic Factor Prohormone Natriuretic Peptide Precursor A Natriuretic Peptides A Atriopeptigen PreproCDD-ANF PreproANP ProANF ProANP CDD Cardiodilatin-Related Peptide Prepronatriodilatin Cardiodilatin Cardionatrin Atriopeptin CDD-ANF ATRST2 ATFB6 ANF CDP
Location (GRCh38)
1:11845709-11848345
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Cause of death analysis Sudden cardiac death diagnosis Sudden death from respiratory system disease Sudden unexpected death diagnosis Mechanical injury analysis
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_006172.4
Sequence length
855.0 nt
GC content
0.5509

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-311.10 kcal/mol
Thermodynamic ensemble
Free energy: -326.80 kcal/mol
Frequency: 0.0000
Diversity: 126.83
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((......(((.((....((((((....((((.((((.(((..(((((.((((..((((..((.((..(((.((((.....).)))..))))).)).))))..))))...(((....))).(((((.((..((((((((((((..(((((...(((...))).))))).....(((.....)))....(((((..((((((.(((......))).)..))))))))))(((((........)))))((((........))))..(((....))).))))).)))))))......)).)))))((((((((....)))))))))))))..))).)))).))))..(((((((((((((((((((((((..((((((((.((((..((((...))))..))).).))))).)))..)))((((((((........))..)))))).(((((..(((((((.((((((..((((....)).)).)))))))))))))...)).)))..(((.(((((((......))))))).)))...(((((((..(((.......))))).)))))........)))))))))...((.(((((.(((((((((((((........)))))))))..))))))))).))....(((((.((.(((((((((((......)))......)))))))).)).))))).......((((....((((.((........))))))..)))).)))))))))))))))))....)).)))............((((...))))..)))))).(((...((((((((((.((......))))))).)))))...)))........
Thermodynamic Ensemble Prediction
..((((((,...,.{((,((....((((((,{..((((.((((.(((..(((((.((((..((((..((.((.,(({.{{{,,....}.}}}..)},)).)).))))..)))),..(((....))).(((((.(({(((((,,((((((..(((((...(((...))).))))).....{({.....}||.,{,(((((..(((((.,(((......))}.}..))))))))))},,,|}}.......}}}|||,,}}}}}}..)))),.{{{....}}}..|,||,|,}})))},....)}.)))))((((((((....))))))))}))))..))).)))).)))).,|((((((((((((((((((((((..((((((((.((((..((((...))))..))).).))))).)))..)))(((((({{........}}..)))))).((({(,.(((((((.((((((..((((....)).)).)))))))))))))...)).)))..(((.(((((((......))))))).)))...((((({{,.{((.......}})}).))))),.......)))))))))...((.(((((.(((((((((((((........)))))))))..))))))))).))....(((((.((.(((((((((,........,,......)))))))).)).))))).......((((....(((,,((........))))))..)))).))))))))))}))))))....}),}))}...........((((...)))),.)))))).(((...(((((((({{{((......))))))).)))))...)))........

Transcripts

ID Sequence Length GC content
NM_006172.4 NCBI
GAGACAGGGACAGACGUAGGCCAAGAGAGGGGAACCAGAGAGGAACCAG… 855 nt 0.5509
Summary

The protein encoded by this gene belongs to the natriuretic peptide family. Natriuretic peptides are implicated in the control of extracellular fluid volume and electrolyte homeostasis. This protein is synthesized as a large precursor (containing a signal peptide), which is processed to release a peptide from the N-terminus with similarity to vasoactive peptide, cardiodilatin, and another peptide from the C-terminus with natriuretic-diuretic activity. Mutations in this gene have been associated with atrial fibrillation familial type 6. This gene is located adjacent to another member of the natriuretic family of peptides on chromosome 1. [provided by RefSeq, Oct 2015]

Forensic Context

A study in rats demonstrated that heat exposure induces rapid upregulation of the NPPA mRNA (Nppa) in the atrium immediately and at 1 hour post-exposure, indicating acute cardiac overload and myocardial damage [Nakagawa et al. DOI:10.1016/J.Legalmed.2011.12.001]. In human heart tissue, the NPPA (NPPA) was identified as a significantly upregulated component of a 62-gene expression signature, with a mean fold change of 3.4108, enabling the classification of various structural heart diseases from controls with approximately 95% accuracy [Fajarda et al. DOI:10.1186/s13040-020-00217-8]. A study in human forensic autopsy cases demonstrated that atrial natriuretic peptide (ANP) mRNA expression in the myocardium serves as a marker of cardiac strain, with significantly lower expression in the bilateral ventricular walls in mechanical asphyxiation and drowning deaths compared to sudden cardiac deaths [Chen et al. DOI:10.1016/J.Legalmed.2012.01.015]. Further research in human subjects showed left ventricular ANP mRNA was elevated in acute ischemic heart disease, right ventricular cardiomyopathy, and hemopericardium, but was low in pulmonary thromboembolism compared to control groups, while bilateral atrial ANP mRNA was lower in recurrent myocardial infarction [Chen et al. DOI:10.1016/J.Forsciint.2012.10.018].