Basic Information

Symbol
NPPB
RNA class
mRNA
Alias
Natriuretic Peptide B Brain Natriuretic Factor Prohormone Natriuretic Peptide Precursor B Gamma-Brain Natriuretic Peptide Natriuretic Peptides B PreproBNP Iso-ANP ProBNP Brain Type Natriuretic Peptide Natriuretic Protein BNP
Location (GRCh38)
1:11857464-11858976
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Sudden cardiac death diagnosis Chronological age estimation
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_002521.3
Sequence length
708.0 nt
GC content
0.5678

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-259.50 kcal/mol
Thermodynamic ensemble
Free energy: -271.20 kcal/mol
Frequency: 0.0000
Diversity: 255.38
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((((..(((((..(((...)))..)))))........((((.(.((((((.(..((.((.((.((.((....)).)).)).)).))..).))..(((.(((((((...((((((((((((((.(.......((((.(((((((((((((........((.....)).....((((((....))))))...((((((....))))))..((((.(((((........))))))))).))))))))).((..((((((((((((((...))))....)))))))))).)).......(((((((...))))))).)))).)))).......).)))))))..(((((((..(....)..))).))))...(((((((.(((((...((........))...))))))).)))))..((.(((...))).))..)))))))....))))))).))).))))).))))....))))))))((((((((.(((........))).)))).(((((((((((((((((((((.((((....))))........(((((.(((.............))))))))..))).....)).))))..)))))))))))).....((..(((((((.(((((......(((((.....)))))..((((....))))......))))).)))))))..)).))))..........
Thermodynamic Ensemble Prediction
.,({(({((.,{((((,,(((,,,|||..|||||..,{...,{{((..{{.,.{{.((.{{.||.)).}}.,(((((((((..{{.(((((({(((..,(((.(((((((.,,|(({{{{((((({{,(,{{,...((((.(((({{{{{{((({{{{.{,,({,,,,(({,.,{{((((((,...}}}))},,.((((((....)}}}))..{(((.(((((........))))))))}.}}))}}}}},{{..{{{{{{(({{{||,...,))),,..)))))))})),)),}....,(((((((...))))))).)))).}}}}......,)})))))))..{{|||||,,{|..,)|,}|}.||||.,.(((((((.(((((...{(,.......})...))))))).)))))..||}|,....}))}))..))))))},,}}))))))}.))).,.))),.,||{|..,||||||,.((.((((.(((........))).)))).)).,...}|||}.}}}},)))))).}.,..)))))))))...{({{..|||.......,,,...))))))))}})}}},}|,,|||.}}}.,,}|,.((((((.....((..(((((((.(((((......,{{{{.,,,.}},,),,,{||,,..}}},......))))).)))))))..))))))))..,,,,,,.

Transcripts

ID Sequence Length GC content
NM_002521.3 NCBI
AGGAGGAGCACCCCGCAGGCUGAGGGCAGGUGGGAAGCAAACCCGGACG… 708 nt 0.5678
Summary

This gene is a member of the natriuretic peptide family and encodes a secreted protein which functions as a cardiac hormone. The protein undergoes two cleavage events, one within the cell and a second after secretion into the blood. The protein's biological actions include natriuresis, diuresis, vasorelaxation, inhibition of renin and aldosterone secretion, and a key role in cardiovascular homeostasis. A high concentration of this protein in the bloodstream is indicative of heart failure. The presence of myocardial injury is a significant predictor of mortality in hospitalized coronavirus disease 2019 (COVID-19) patients, and there is evidence of increased levels of natriuretic peptide B in hospitalized non-survivor COVID-19 patients. The protein also acts as an antimicrobial peptide with antibacterial and antifungal activity. Mutations in this gene have been associated with postmenopausal osteoporosis. [provided by RefSeq, Aug 2020]

Forensic Context

A study in Wistar rats demonstrated that heat exposure induces rapid and significant increases in the mRNA expression of the NPPB in the ventricle, peaking immediately post-exposure, indicating acute cardiac overload and ventricular pressure [Nakagawa et al. DOI:10.1016/J.Legalmed.2011.12.001]. A separate review of human multi-omics studies identified the NPPB as a top protein associated with aging in plasma proteomic analyses, highlighting its role as a proteomic aging biomarker [Solovev et al. DOI:10.1016/j.mad.2019.111192]. A study in humans demonstrated that the NPPB serves as a marker of cardiac failure and myocardial mechanical strain, with immunopositivity in the left ventricular myocardium and pericardial fluid, and elevated mRNA levels observed in cases of cardiac failure [Maeda et al. DOI:10.1016/J.Forsciint.2010.07.024].