| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAGCGCACCCAGCCGGCGCCGCGCAGCACUGGGACCCUGCUCGCCCUG… | 1055 nt | 0.5213 |
This gene encodes a preproprotein that is proteolytically processed to generate multiple protein products. These products include the cardiac natriuretic peptides CNP-53, CNP-29 and CNP-22, which belong to the natriuretic family of peptides. The encoded peptides exhibit vasorelaxation activity in laboratory animals and elevated levels of CNP-22 have been observed in the plasma of chronic heart failure patients. [provided by RefSeq, Oct 2015]
A study in rats and mice demonstrated that the NPPC mRNA, used as an oligodendrocyte-specific control transcript, showed no alteration in levels after traumatic brain injury, confirming the specificity of the astrocytic vimentin response [Ekmark-Lewén et al. DOI:10.3233/RNN-2010-0529]. A study in mice demonstrated that the NPPC co-localized with miR-21/LacZ in the great majority of positive cell bodies in the brain, identifying it as a marker for oligodendrocytes where miR-21 is highly expressed [Miguel-Hidalgo et al. DOI:10.1016/J.Pnpbp.2017.08.009].