Basic Information

Symbol
NPPC
RNA class
mRNA
Alias
Natriuretic Peptide C CNP C-Type Natriuretic Peptide CNP2 Natriuretic Peptide Precursor Type C Natriuretic Peptide Precursor C
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Mechanical injury analysis

MANE select

Transcript ID
NM_024409.4
Sequence length
1055.0 nt
GC content
0.5213

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-366.10 kcal/mol
Thermodynamic ensemble
Free energy: -386.19 kcal/mol
Frequency: 0.0000
Diversity: 228.22
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....(((..((((..(((((((((((((((((((...((((.......)))))))))((((.((((((.(((......))).((((.((((.......((.(((((((((((.(((.((.(((.(((((.((((((.(((((((.................)))))))(((((((.(((((.((((..((((((...((((.(((........)))..(((((((((((.(((...)))...)))..)))))..))).))))))).))).)))).))))).)))))))...))))....)).)))))))).))....))).))))))))))))).......))))))))((((.((.......)).))))(((((((((((.....)))(.(((((((....))).)))).)(((....)))......))))))))........((((((.........((((((.....((((((...))))))))))))..........))))))..)))))).))))..)))).))))))))))..))))..)))..((((((...((((.(((((((..(((((.......(((.....)))(((((...)))))...)))))...))))))).))))(((((((((................(((((..(((((..(((((...........((((((((((.((((((..(.((...(((((((((.((((((..((((((((((......))))))))))....((((((.(((....))).)))))).)))))))))).)).)))...)).)..)))))).......(((((((...)))))))..)))).)))))).((((((((((((.(((....(((((....((((((((((........(((((((.((.((((((.....)))))).))...)))))))......)))))))))).....)))))......))).))..))))))))))..))))))))))..))))))))))))))..........((((...))))...))))))...
Thermodynamic Ensemble Prediction
....(((..((((..(((((((((((((((((((...((((.......)))))))))({((,((((((.(((......})).((((.((((...{{..((.(((((((((((.(((.({.(((.(((((,(((((({(((((((.................))))))}(((((((.(((((.((((..((((((({,,{{(((((.,,,,,..{{...}}.|||||{{{,{{{...))}...}}}..,,,))}})),,).))))).))).)))).))))).))))))),}.)))).,..)}.)))))))).))....))).))))))))))))).......))))))))((((.((.......)).))))(((((((((((.....))){,(((({((....))).))}}..{((....))}......))))))))........|(((((.........||}|||,....((((((.,{|||||......,}}.}}},,.}))))))..)))))).))))..)))).))))))))))..))))..)))..{({((({.{((((.(((((((,((((((......,|{{.....))){{{||,..}))))...}}}))}}.}}}}}}}.}}}{(((((({{...............{((((((..(((((..(((((...........(((((({(((.,{{{{{.{({({.,(({({,((((.((((((..((((((((((......))))))))))..,.{(((((.{{{,,,,))).)))))}.)))))))))).,).))).,.))}),,||}}},,}}}.,.(((((((...))))))).,,})}.}))))).(((((((((({(.(((....(((((....((((((((((.,,,,...(((((((.({.((((((.....)))))).})...))))))),,},..)))))))))).....)))))......))).))..))))))))))..))))))))))..)))))))))))))),.......}}}}}}}}}.})}....,.......

Transcripts

ID Sequence Length GC content
AGAGCGCACCCAGCCGGCGCCGCGCAGCACUGGGACCCUGCUCGCCCUG… 1055 nt 0.5213
Summary

This gene encodes a preproprotein that is proteolytically processed to generate multiple protein products. These products include the cardiac natriuretic peptides CNP-53, CNP-29 and CNP-22, which belong to the natriuretic family of peptides. The encoded peptides exhibit vasorelaxation activity in laboratory animals and elevated levels of CNP-22 have been observed in the plasma of chronic heart failure patients. [provided by RefSeq, Oct 2015]

Forensic Context

A study in rats and mice demonstrated that the NPPC mRNA, used as an oligodendrocyte-specific control transcript, showed no alteration in levels after traumatic brain injury, confirming the specificity of the astrocytic vimentin response [Ekmark-Lewén et al. DOI:10.3233/RNN-2010-0529]. A study in mice demonstrated that the NPPC co-localized with miR-21/LacZ in the great majority of positive cell bodies in the brain, identifying it as a marker for oligodendrocytes where miR-21 is highly expressed [Miguel-Hidalgo et al. DOI:10.1016/J.Pnpbp.2017.08.009].