Basic Information

Symbol
ARID1A
RNA class
mRNA
Alias
AT-Rich Interaction Domain 1A BAF250 B120 BAF250a SMARCF1 C1orf4 P270 SWI/SNF-Related, Matrix-Associated, Actin-Dependent Regulator Of Chromatin Subfamily F Member 1 AT-Rich Interactive Domain-Containing Protein 1A AT Rich Interactive Domain 1A (SWI-Like) ARID Domain-Containing Protein 1A SWI/SNF Complex Protein P270 BRG1-Associated Factor 250a SWI-Like Protein Osa Homolog 1 C10rf4 HOSA1 OSA1 HELD SWI/SNF Related, Matrix Associated, Actin Dependent Regulator Of Chromatin, Subfamily F, Member 1 AT Rich Interactive Domain 1A (SWI- Like) Chromatin Remodeling Factor P250 BRG1-Associated Factor 250 OSA1 Nuclear Protein Brain Protein 120 BAF250A BM029 MRD14 CSS2 ELD
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference

MANE select

Transcript ID
NM_006015.6
Sequence length
8595.0 nt
GC content
0.5752

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-3294.80 kcal/mol
Thermodynamic ensemble
Free energy: -3437.43 kcal/mol
Frequency: 0.0000
Diversity: 2200.73
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....(((((((...........)))))))....((.((((((.((((((((((.(((((((((((.(((((((((((((((((((((....))))...))))))))((((((.(.(((((.(((((.((.......)))))))((......))..))))).)))))))(((.((.(((((.(((((((((((((((.(((((.((.(((...))).)).))))))))))))))).)))))))).)))).))).....((((.(((......)))))))..))).))))))))))((((((((((((.......))))))((((((((((((.(((((((.............((((.(((..(((((((..........)))))))((((..((((((.((((((..(((((((((((....((((..((..((((((.((.((((.((.((((..(((......))))))).....)).))))..)).))))))..)).)))))))))))))))..))))))..))))))....))))((((.(((((..(((((((..(((..((((((.....))))))..))).((.((((((.((((.(((((((((.((((((((((((...(((((((((((((((((((((((((((((((((((((((.(((((.....))))).)))............((((...(((((((...)))))))))))........((....)).))))))..(((((((((((((((((((..(((.((((.((((((((............((.((....))...)))))))))).)))).((((((((.(........).)))))))))))))))))))))))))))))).((((((((..(((.(((......))).))).......(((..(((((((((((((.(.((..(((.(((((((((((.((((.(((((....))))).))))..................(((.............((((.......))))..............)))...)))))).))))))))..)).))))))).(((.((.....)).)))...)))))))..))))))))))).))))))))))))..)))))).((((..(((((.((.((((((((((((((((((.((((.((.(((((((.((((((((((((((((((.((((((((((((.(((((((.(((.((((....)))).)))..(((((.(((...((((((((..(((((....(((((((.....(((((.((....)).))))).......))))))).....((.((((((((......))))).))).)).(((((..(....)..))))).)))))))))))))...).)).)))))..))))))).)).)))))))))....(((((((......)).))).))...).)))))).))))).))))).)).))(((((((((...(((......))).)))))).)))(((((......)))))....)))))))))))))))....(((....)))(((.....)))..............((((((((((((.((((((((.((..((...((((.((((.((....))....))))))))..))..)).))))).(((..(((((((((...((.(((.((....(((((((((.((..(((((.......)).)))..)).)).))))).)).....))))).))..)))))))))...)))..................((((.....((((.((((.((((((..((((.......................(((...)))...(((((((((.(((((...((((.....((((.........(((((.((..((...(((((((((.(((...(((((((((..(((((...((((((......((.(((..(((((.(............).)))))..)))...))..........(((((......................))))).............(((((((((......((((((.((..................)).)))))).........((....((..(((((((.........((((.........))))..(((((((((...((.((((............(((((.(((.((.(((...))).)).)))...))))).)))).))...)))))).)))........((((((((..............(((((((((((((((..(((((((......)))))((((.((((.(((((((.(((((((((((((((...(((.(((((((((..((((...(((((((..(((((((.(.((((......)))).)))))))).........................((((.(....).)))).............)))))))...))))....))).)))))).))).))))))).........((((((......).))))).....(((((..((.(((((((...)))))).)..))...)))))..)).))))))..(((.....))).((((.((((......).)))...))))...((.....)).....(((((....(((((..........(((((((((((((((....(((..((....))..)))))))).....)))).))))))..........)))))...))))).......)))))))))))))))(((.((((...((((((((((.((...)).))))..........))))))......))))))).....))..)))))).))))))))).......((((((((((((((((((...((((..((....))..))))...))))).)))))).(((((....)))))..............))))))).....((((....))))......((((......)))).))))))))((((..((..(((((((((.....)))))))))..)).....)))).....)))))))..))...)).))))))))).................((((....)))).................))))))..)))))((((((((..((....((((....(((((.......(((((((..((((((.(((.(((((...(((((..((..(((((((..((((..((..((....))..)).))))...))).))))..))..))))))))))))).))....))))...)))))))......................((((...))))......)))))...)))).))..))))))))......((((((...(((.....)))....))))))...)))))).)))))).))))))))).))..))))))).........)))).....))))...)))))...))))))))).....)))))))))).)))))))).....))))...(((((((((.....((((..(((..((((.(((((((.(((((....))))).............((((((.(.((((.......((.......))......))))...).))))))(((.(((....))).))).........((((((...(((((...((((((((.....((((((......)))))).....)))))((.((((((((..........(((((.((...((((((....((((.(....).))))...))))))..)).)))))....((((....))))...)))))))).))..)))))))).))))))......)))))))))))..)))..)))).....(((((..(((...(((((..((((((.....(((.((((...))))...)))...)))))).)))))..)))..)))))..(((((((...((((((..........))).....((((((....))))))........(((..(((((((.(((((((...((((..((((..........((((((((....))))))))..))))..))))))).)))).)))))))...))).(((((((.....(((((.((((.((.......)).)))).)))))))))))).))).)).)))))))))))))).................)))))))))))))))..))).))).)))).)))))))))))..)))).(((..((((.((((((......(((......)))....))))))..))))....)))....(((((.....)))))..))))))))))))((..((.((.((....)).)).))..))...(((((((...)).))))))))))).......))).))).)))).))))).)))).))))))..)).........((((......((....)).....))))...((((((((.......))).))))).)))))))..))))).....((((...........((((......))))(((((.((((((((....((....)).))))))))..))))).)))).))))......((((.....))))))).))))))))))).(((...(((((((.....)))).))).)))...))))))).)))))...)))))).(((.(.((((.((....)))))).).)))..((((.............))))......(((((.((((((....((((.(((...((((.........(((((........(((((((....))))).)))))))..((((((....))))))..))))....))).))))((((((((.............)))))))).....)))))))))))))))))).)))))))))).((((......)))).........(((........)))..(((((..((((((((((........(((((((((((.......))).))))..))))......))).)))))))...))))).............)))))))).........((((((.(((((((.....((..((((...))))..))((((((..(((((((((..(((((..((((((((((((...((..........))...)))))))..(((((.((......))...))))).((((((((........)))))))).(((((..((....))...))))).(((...........)))(((((((((....(((.((((.(((((.(((.(((.(....(((.(((....))).)))..).))))))(((((.....)))))......))))).)).)).)))...))))))))).......)))))....))))).)))))...))))....))))))....(((((.((((((((((((.(....))))))))((((...(((((((.((((((...))))))))...(((((((.((((((....((((.(((..(.....)..))).)))).)))))))))))))..)))))))))..((((((((((((....)).)))..))))))).....))))).))))).........((((...))))))))))).(((((........)))))..........(((((((((((((((((.((((((...(((((((..((.((((......)))).))(((..((((((((.......((((((...((((((.((((((..((((.....))))..)))))).......((((((........)))))).....((((((..(((((.......(((((((.(((.(((((((((((...((((((((.(((..(((.((..(((((((.(((......(((........))).........(((.((..(..((.((....))))..)..)))))......))).)))))))(((((((....((.(((....)))))...((.....)).((.........))..))))))))))))..((((((.((((.(((..((((..(((...(((...))).)))..)))).))).(((((((.........)))))))....(((((...))))).)))))))))).(((((........)))))....(((....)))..)))))).))))).(((.((((......(((((((........((((((..((......))..))))))....)))))))..((((((((...))))))))((.(((.((..((.((((...))))))..)).)))))((((((.((.....)))))))).....))))))).....((((((((....))....)))))))))))...))))))))).)).)))))..((.....)).))))).))))))........(((.((((((((((((((((((((((((((.((((.....(((.((.(.(((((((......(((((((...)))))))....))))(((((.......)))))..((((((((....((((......))))..))))))))(((......))).(((((((((((((((((((...)))).)))))).......(((((.(((((((.............))))))).((((.((((((((........)).))).))).))))......)))))..........))))))))).....((((.((.......))))))))))))))))))))))))((((((((((.(((((((...(((.((((.....))))))).......(((((....)))))..((((((((.((...(((((((((((((...))))((.....))(((((.....)))))..((((((((....(((.(((..(((..((((.((((...))))))))...))).))).))).......((((((((.(((((((.(((....(((((((((..((........))..))......)))))))......((((((((...))))).))).))).))).))))...(((((.......)))))(((((....)))))..((.....)).))))))))((((.((((...))))..))))((((....))))((((((.....))))))))))))))......))))))))).)).))))))))((((....))))......(.(((.((.((((((.(((((((((((((...))))..)))...)))))).))))))..))))))...................))))))).)))))))))))))))...........))))))))))).)))))..)))....................))))))...))))))...))))))))..)))......(((.(((((.......(((((((.(((((((((.(((((((((......))).)).)))).))).))))))(((((.(((((((.....))))))).)))))(((((.((((((((((((((........(((((.....(((((.....)))))...........((((((...))))))...........(((((((((...............((((((.........((((((.(((((.....((((((..((((((......))).....))).))))))...)))))))))))((((((((...))))))))((.((((((((((((((((.((((((((.....)).)))))).)))))((((........))))..((((((((((......(((.((.....)).)))......((((((..((.(.((((((((..........(((((((......)))))))(((((((............(((((......))))).(((.((((.........))))..)))........)))))))...................((((((.....))))))....(((....))).......((((((....))))))...(((((((..((((......))))...)))))))......((....)))))))))).).))...)))))).......))))))))))..(((((((..(((((.((.(.(((.....))).).)))))))..)))).)))....(((.((((((.((....)).)))))))))))))))))))).))....))))))(((((....))))).....((((...))))))))))))))))))......)))))))))))))).)))))....)))).))).....)))))))).(((((((...((((.....))))...)))))))((((((.((...)).))))))((((....)))))))))))............((.....))...)))))).))))))))))))))))).((((((.....(((((((((((((((((...))))))))((((((...))))))...)))))))))..))))))...)))))).
Thermodynamic Ensemble Prediction
......{{{{{({,,,,,,,,,||||||}{,....,,((((((,({((((((((.(({{..(({{{.{{{{{({{({({{((((((((....)}))}}}}}}},}||{(((({.,.{||||.(((((.((,....,.))))))),|.{{{{.||.,|||||{|}}}}))|||}|{{(((({{(((((((((((((((.(((((.((.(((...))).)).))))))))))))))).)))))))).)))}.))}},}}.((((.(((......)))))))..))),)))))))}|||||.{|||||||..,,.,,))))}|((|(((((((((((((((((({,{,.,..((({((((((((,.(((((((........,.)))))))||,|}}||((((.((((((..(((((((((((....((((.,{(..((((((.((.((((.((.(((({.,((......))))))).....)).))))..)).))))))..)).)))))))))))))))..))))))..))||||{{{,|,||,((({(((((..(((((((..(((..((((((,...,))))))..))).((.((((((.((((.(((((((((.((((((((((((...(((((((((((((((((((((((((((((((((((((((,{((({((((.|(((|.,,{({.,...,,...((((...(((((((...)))))))))))..........}},})).,)))))}}(((((((((((((((((((..(((.{(((,(((((((({,.,........},.},|||.},...})))))))}}.)}}}.((((((((.(........).))))))))))))))))))))))))))))))}||||||||,.(((.(((......))).))).......(({{,{{{{,{{|||(((|{.,,.,||{.(({(({(((((,((((.(((((....))))).))))..|,...,,,..,....,||||,,..........((((.......)))).........,..},)))...))))))))})))))}{{|,.{(((((((({..{(((.({(......))))))))),,)))))),,))).))))))))))))..)))))).((((..(((((.(,{((((((((((((((((({{((({,((.(((((((.((((((((((((((((((.((((((((((((.(((((((.(((.((((....)))).)))..(((((.(({...((((((((..(((((....(((((((.,...(((((.((....)).))))).......))))))).....((.((((((((......))))).))).)}.(((((.,,....}..))))).)))))))))))))...).)).)))))..))))))).)).)))))))))....(((((((......)).))).)).,.).)))))).))))))))))).)).))(((((((((...(((......))).)))))).)))(((((......)))))....)))))))))))))))....(((....)))(((.....)))..............((((((((((((.((((((((.((..((...((((.((((.((....))....))))))))..))..)).))))).(((,.(((((((((...((.(((.((...,(((((((((.((..(((((.......)).)))..)).))}})))).)).,...))))).))..))))))))).,.)))..................((((.....((((.((((.((((((,,({{(..............,........(((...)))...(((((((((.(((((...((((.....((((.........(((((,((..({...(((((((((.(((....,.{{{{{{.{((({((({(({{{,.{{{{,,,.(((,,{(({({{,,..........|,,|||,..)))...}}.,....,,,,|,||{.(({{{{...,{...((((...)))).,|,........,,(((((((((.,..,,(((({{.{{.........{{{......}}.|||||},....,.},||,...{{..,{(((((...,,,..,||||........,}}}}.}||,{{((((...,,.||||...,,....|,,(((((.(((.((.(((...})}.}),))),..))))).}}}}.}}..,)))))),,,}......,,{(((((((...{,.,..,,|..(((((((((((((((..{{,{{{(,.....}}}}|((((.((((.(((((((.(((((((({((((((...(((.(((((((((..((((...(((((((..(((((((.{.((((......)))).}))))))).........................(({{,|....},)))}.............)))))))...))))....)))}}))))).))).))))))}.........((((((......)}})))).....(((((..((.,((((((...)))))).}..))...)))))..)).))))))..{{{.....}},.((((.((((......}.)))...))))...((....}}|,....(((((....(((((..,.......(((((((((((((((....(((..((....))..)))))))).....)))).)))))).......,..)))))...)))))..,..,,)))))))))))))))|{{.((((...((((((((((.((...)).)))),.........})))))......))))}}}.....))..)))))).))))))))).......(((((((((((({(((((...((((..((....))..))))...))))).}))))).(((((....))))),..,..........))))))).....((({...,||||......,|||,,....)))}.)))))))|((((|.((..{((((((((.....))))))))}..)).|...}))),....,))))))..),..})).))))))))}.................((((....))))..........,......)))))).})})))|{{||||{..{,..,.||||...,|||||.......{(((((({.((,{{{.((({(((((...{{{({..,(,|((({,{{..||||}}{,..,....,}).,))}))))},,))}|))||..}}..})))))}}}}))).}}....},},...))}|||,................))}...{(((...)))).,,...|}}}}...}}}},}}..}}}})))))},...((((((...(((.....)))....)))))).}.)))))),)))))).))))))))).)},,))))))).........)))).....))))...)))))...))))))))).....)))))))))).)))))))).....))))...,((((((((.,..,((((.,(((..((((.(((((((.{((((....))))}.............((((((.,,({(((......{(,,....,))}........)}))).))))))(((.(((....))).)))......{{{,(((((.((((.,,{..((((((((.....((((((......)))))).....)))))}))}(((((((.......,..(((((.((...((((((....((((.(....).))))...))))))..)).)))))....((((....))))...)))))))},.,.))))...))}))),))}.....)))))))))))..}}}.|))},.....,{{{,((((((..,((((((..((....))..).)))))...}..))))))..||||,|{{,,..,..(((({(((....))).))}}}..}|.||,.,}}}.}}},}||.....((((((....))))))...,....{{{,,(((((((.(((({{(.,.((((..((((..........((((((((....))))))))..))))..)))}))).)))),))))))),,,||}|(((((({....,(((((.((((.((.......)).)))).))))))))))))}}},.}},..,},)))))))))................,)))))))))))))))..))).))).)))).)))))))))))..)))).(((.{((({.((((((......(((......)))....))))))..))))....)))....(((((.....)))))..))))))))))))((..((.((.((....)).)).))..))...(((((((...)).))))))))))).......))).))).)))),})))).)))).))))))..)).........{{{{......((....)).....,,},.,.((((((((.......))).))))),)))))))..))))).{{,,((((...,,,...,.((((......))))(((((,(((((((({...((,,,,||.|||}||||,.}}}}}}||||{{,{{({{{(.((((,....||||||,,||,,,,,,|||.{{{...{{{((((.....))))|||,.}})}..{((((((((,{((..((((..,.((((((((((.((....))))))...,,|,................,.,})|{.(((((...))))).||.....((({((....||||,}}.......,{(((((((((((((((((.(({,,|||{,,{(||...((((((....)))))).,||,{{{{{|||{,,||((((((((.............))))))))....((((((((....)))))))),,.,.|||||,((((......)))).}..,}...,,{......,.|||..,,|||..{{(((((({,...,,(,.{{{||||||||}}}...,|||.}}})}})})).})}}})))},))),)),,.}))))}).))))}({.{((((,|{((,,{({(((((((,...(((((((...,,{(..({{{...,},|..|,((((((..(((((((((..(((((..((((((((((((...((..........))...))))))),.(((((,,,.{{,..},...|||}|.((((((((......}.)))))))).|||{{..({....)),,.})))),|,,......{{{{.|{.(((((((((....(((.((((.(((((.{(,{(((.{.,..(((.(((....))).)))..).)))))}(((((.....)))))......))))).)).)).)))...))))))))),}.}}}})))))....))))).)))))...))))....))))))....{((({.(((((({(({{{.|.,,,)))}})))((((...(((((({.((((((...})))))}}...(((((((.{{(({{....{{{{.(((,,(.....}..))).}})),))))},))))))).})))))))))..((((((((((((....)).)))..))))))).,,,,))))}.)))))...,,,,..{{{{..,)))})))))))....,,........{{((({{........}}}}}}},,,,...,,,.,,,,,.))))))}.....}}}}})).}...))))).)),(((........)))..(((((........))))).((((((..((((.....))))..)))))).......((((((.,....,.)))))))))))))))))).,.))))))...)))}||)}}))).)))))}|||,|.,,|||||,})}}},.}}})})}.}})|}))))}|}},....{{{......,,}}|.,,,.,|||,.,,|,..,..,|.}})}}})|,|,,,.|}}||...}}.}}}}))}},....}||||||...((.(((....))))).,|{({{...{{{{((.,,,,,,..{((({((({..,}}.||||{(((.{{((,{,,..,,{{,,{{{,,.(({...})).}}|,.})))|))}.(((((((.,,...,,.)))))))....(((((...})))).))))))}}},,)),{({{{{{,.||||{,...{(((.,..||}..||||||,}}}}..|||,|..,..,.{{(,(((((........((((((..((......))..))))))...,))))))),.((((((((...)))))))),{,|({|{{|,||,{{({,,,|}},||,,}}.,||||(,((,.,,|}.}}}))))))}}.}}}.}}}||||.....,,||}|)}}}}})))).||||||||,|||{{,,|||||{||.,,...,}}..({.....)).}))))},.||.|,..{,,.....,||{{||,||,,{{{{{,,,{(((((((({(({......(,(({({(({(((({{({{{({{(((({,{||}||{|......,}{{{{{....,..)))),..{(((((((....((((......))))..))))))))|||,,},},}}}.{||||||{|},,,}}}},....,|{|||}}}))))).,},|||{,.|||||||,,,,,,,,....,))))))),||{,,|||{||,|}}},,,,,||{|||{}||,||||,....,|,||,...,}.}),.)))))))),....{((((.((.......)))))))...,,,,,.,,,{,,,,((((((((((.(((((((...(((||(((,,..,}}}}||||......,,|||}..,)}))),,.{{{{{{{|||.,,((((({{,.,,(((({(,|,((({{.{{,(((({,,...|||},.,||,|,}},,..,{||,({,..(((..((({,{(((...))}}))))...))),))),)))}....}}})),,},)}))))}))))}}{{{{,,((((((({....{((({,,{{{.{{{{{...}.}}||,{{.,..((((((((...|}})).)))||}.}})}}})))}}}|||||.......}}}}}(((((....))))).......{{{{((({{{{|.((((.((((...))))..))))..|,,,.,|||,(((((({...,)))))),|.||||.......,}))}))))}},)))))))))|||,,,..,}}}.....,}}}}}}}}.)})))))),))))..,,,,{...||||,||||||.}},......,))),..,}},.,}}}...,.})).)))).,))))))).))))))))))...))}....}))))})})))))))))))))))))))))))))))})}}}},....,}}))).)))))))))))))),,,}}}}..,},,,.},,|||,|||{|.,,..,.(((((((.{{(((((((,((((({{({......|}|||},}}}|,|||.||||,.(((((.(((((((.....))))))).))))),{|||.{{{{{{{{{{{{{,.{(((..((((.{,....,...,.,,)))).)))}.........{{{{{{,..}}})}}.............{{{{{,.{{.{{{{{{{,....((((((.........((((((.(((((.....((((((.,{(({({......))),,...}}},))))))...)))))))))))((((((((...))))))))((.((((((((((((((((.{((({{,,,....||,{((((......))))}..},|,,,|{|,..((((((((({......(((.,,.,,,.},.})}......((((((..((.(.((((((((..........(((((((......)))))))(((((((.,{,.......,(((({......})))}.{{{.((((,........))))..)}}....})}.))))))).......,,...,,.,,,,((((((.....))))))....|||....})}....,..((((((....))))))...(((((((,.((((......))))...)))))))......((....)))))))))).).))...)))))).......))))))))))..(((((((..(((({{({.{,(((.....))}.},)})))))..)))).))).....,|.,(((((.((....)).)))))))))))))))))))).))....))))))(((((....))))).....,{{{...})}}.}))))))),)),)))))}.)))))))))))))).)))),....)))).)}),,,,,|||}}}}}.(((((((...((((.....))))...))))))}{{{{{|,||...)).,}}}))|((({..{((,....)}),.))))}{({{{{{...{{...{,,.......,))},.)),..))))))}{(((((..,,.(((((((((((((((({...})))))))((((((...))))))...))))))))),,)))))}....,))},.

Transcripts

ID Sequence Length GC content
CUCCUUUCUCCGGCAGCAGAAAGCGGAGAGUCACAGCGGGGCCAGGCCC… 8595 nt 0.5752
CUCCUUUCUCCGGCAGCAGAAAGCGGAGAGUCACAGCGGGGCCAGGCCC… 7944 nt 0.5731
Summary

This gene encodes a member of the SWI/SNF family, whose members have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. It possesses at least two conserved domains that could be important for its function. First, it has a DNA-binding domain that can specifically bind an AT-rich DNA sequence known to be recognized by a SNF/SWI complex at the beta-globin locus. Second, the C-terminus of the protein can stimulate glucocorticoid receptor-dependent transcriptional activation. It is thought that the protein encoded by this gene confers specificity to the SNF/SWI complex and may recruit the complex to its targets through either protein-DNA or protein-protein interactions. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] CIViC Summary for ARID1A Gene

Forensic Context

A study in mice demonstrated that the ARID1A transcript increased in relative abundance postmortem, with its functional categorization as a cancer-related gene and chromatin remodeler [Pozhitkov et al. DOI:10.1098/rsob.160267].