Basic Information

Symbol
NPTX2
RNA class
mRNA
Alias
Neuronal Pentraxin 2 Neuronal Pentraxin II Neuronal Pentraxin-2 Apexin NP-II NP2 Neuronal Activity-Regulated Pentaxin NARP
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_002523.3
Sequence length
2713.0 nt
GC content
0.5916

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1132.90 kcal/mol
Thermodynamic ensemble
Free energy: -1179.01 kcal/mol
Frequency: 0.0000
Diversity: 732.88
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((....(..(((((((((.((((.(((((((.(((((((...)))))))(((((((.(.(((..((((((.(((....(((((((....)))(((((((..(((((.(((...))))))))....((((((((((.((((..(((((.((...)).)))))..))))))))).))))).))))))).((((((.((((((.((((((.(.(((.((..((((((.((....)).)).))))((((((((....((((((((.((.(((....)))..)).)))))))))))))))).)).)))))))).))))))))..))))))))))...))).))))).)..)).).).))))))).(((((((((((((((.....)))))))((((((((.(..(((((((((((((((((.(((..((((.(....).))))...)))..))))))))((((((((((.((((((((..((((...))))((.(((.((((((((((((((.((.((((.((..((((((((.((((((......(((((((((((((((((((.((((.((..((((..(((.((((.((..(((((.((((....))))..((((...........)))))))))..))))))...)))..))))..)).))))))))))))))..(((((......)))))(((((........)))))(((((((((((....(((((...((.....((((..((.(((((.((((((((.(.(((((.(((((.(((((((((((((.(((.((....))...))).)))(((((......))))).........)).)))))))).))))).((((((((..((((........(((((.((((.(((...((((.((.(((.......))))).))))...)))))))))))).))))((((.((......(((((.(((((((((((((......(((.((((((((((..((((((((....))).....((((.(((((......)))))))))(((((....((((......)))).)))))(((((((.((((((.(((.((.((.(((((((.......))))))).))..)).)))((((((.(........).))))))..)))))).)).....)))))..((......))))))))))))))))).))).......))))).)))))))).)))))......)).))))...))))))))..(((.....))).))).))).)))))))).))))).))....)))).))...)))))..))))))))).))((((....))))............)))))))))......))))))........))))))))..)).......)))).))))))))..(.(((((.......))))).)((((((((.......))))))))))).))))).))).)).((((((......))))))..(((.(((((((((....((((...(((((((....((((((....((..........))))))))((((((.((....)).))))))(((((...)))))((((((((...(((((((((((((((((.....(((...((.(.(((((.......(((((((((((......)))))...)))))).....))))).).))..)))))))).))))))).....(.(((((..((((((((((......)).))))))))))))).)))))).)))).)))).))))).))...)))).))))))))).))))))))))).)))))))))).))).)))).))..)))))))))(((.((((((((((((((.(.((((......)))).)..))))))(((((..((((((...)))))).......)).)))..(((.(((.....)))))).(((((((((..(((...((((...((.(..(((((...)))))..).)).(((((......)))))..))))....))).((((((..(((((..((.(......).)).))))))))))).((((((.....)))))))))))))))))))))))..)))....(((((((((((((((...(((((........(((((..((.....))..)))))....)))))....))))).))))..(((........)))...))))))....((.(((...))).)))))))))).))))))).((.(((((......)))))))..((((((((((((.........)))))))))))).((((((((((.((...)).))))))))))..)))))))))))))..)...))))))((((((.....(((..((((((.((....)).)))..)))..))).....((((((((((...................(((.(((((((((........))).)))))))))...(((((((.((((.....)))))))))))...((((((((....))))))))....))))))))))...))))))...........................(((.(((..((((((.....((.((.((((((((..(((((.....(((.(((((.............)))))...)))......)))))..)))))))).)).)).....)))))).))).)))
Thermodynamic Ensemble Prediction
.(((((({,,,(..(((((((((.((((.(((((({.(((((((...}))))))(((((((.(.{((..((((((.(((..,.(((((((....|||(((((((..((((..((({{{||,|||||....,|||||||||.((((..(((((.((...)).)))))..)))))})))})))),.)))))))}|(((((.((((((.((((({,(.(((.((..((((((.((....)).)).))))((((((((....((((((((.((.(((....)))..)).)))))))))))))))).)).)))))))).))))))))..)))))))))).,.))).))))).)..)).}.).))))))).(((((((((((((((.....)))))))}|{((((({(,.(({(((((((({(((((.{((,.((((,,,,,,|.}}}|,..||}..}))))))){{{|||||{|,|||{|||,..{||||,,})))(({((({((((((((((({((,,,,((((.{{,.((((((((.((((((...,{.(((((((((((((((((((.((((.((.,((((..(((.((((.((..(((((,((((....))))..{(({.....,.....})))))))).,)}))))...)))..))))..)).)))))))))))))){{(((((......)))))||(((.,....,,))})}|||((((((((....(((((,.,((.....(({(.,{{.(((({.{(((({|,,{.{{{{{.(((((.((((((({{{(((.(((.((....))...))).)))(((((......)))))...,,,...,),)))))))).))))).(({(((((.,((({........({(((.((({{(((...((((.((,(((....},.}},}).))))...)))))))))))).})})((((.((.,,,..(((((.(((((((((((((......(((.((((((((((..(((({,{,.,,{||,...,,||({,(((((......)))))))}|(((((.,,.{{{{.....,)})).)))))|(((({{(((({((.(((,({{{,.(((.{.{{{|||.,|||||||,||..,},.})))).})))}}}}}}..}.)})|||..,,}}|,}},}}}).))))},.{({.....))))))))))))))))).)))..,}...))))).)))))))).)))))....}.)).))))...))))))))..|||,,,,,|||.}}}.)))})))))))).))))).}},,,|}}}..},...))))),.))))))))),}}((((....))))............)))))))))...,..))))))........)))))))),,}|,,.....}))),}}}))}))},{.(((((.......))))),}(({(((((.......))))))))})},)}))).}))})},,(((((......}))))},,((({(((((((({.{,.{(((...{{({((({,.,((((((....,...........),))))))((((((.((....)).)))))){(({{.,.))}},((((((((...(((((((((((((((((.....,(({..{{.,.(((((.......((((((,(((({.....}))))},.)))))).....))))).}.))).,,.)))))}})))))),....(.((((,.,((((((((((......)).))))))))))))).)})))).)))).)))).)))))..,...))}},))))))))).))))))))))).))))))))))|}}}}))})})}.})))|||||,..((((((((((((((((,(.((((......)))).).})))))))......((((({...)))))}..{{{{{||{||,...,,,|||,.}.,)))),..(((((((({..{{,{(((((.....))))))((((,,,.,}}|..{.{,.{{{{|......)}))),})).......,,.(((((,.,(((((..{(,.....,,)..,.))))))))))),((((((.....)))))))))))))))))))))))).)))},.{(.(((((((((.(....}))).)))))).)}||||,}}||,,...||..|||||.,,{,,.,},,.}))))}})}||..(((,,,,...,}}}...}}}}}....|||,|||...))).}}},)))))).})))))}.((.(((({......)))))))..{(((((((((((.,.....,.)))))))))))}.((((((((((.((...)).))))))))))..)))))))))))))..,.,.})))))|..,,,....{({(,,((,,(({(,,{{,||.,,,..}}},,,,,,,}}.((((((((((.,.................(((.(((((((((........)}),)))))))))...(((((((.((((.....)))))))))))...((((((((....))))))))....))))))))))...,||||..{{{{{,...,}}}},..,,,.,||.,|||,{{|,,{(((((.....((.((.((((((((..(((((....,(((,{{{{{.............))))).,.)))......})))}..)))))))).)).)).....)))))).,}}.}},

Transcripts

ID Sequence Length GC content
AGAGUGCCGAGCAGCGCGGUGGGUGCGGCUGUGAGACGGCAGGAGACUU… 2713 nt 0.5916
Summary

This gene encodes a member of the family of neuronal petraxins, synaptic proteins that are related to C-reactive protein. This protein is involved in excitatory synapse formation. It also plays a role in clustering of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA)-type glutamate receptors at established synapses, resulting in non-apoptotic cell death of dopaminergic nerve cells. Up-regulation of this gene in Parkinson disease (PD) tissues suggests that the protein may be involved in the pathology of PD. [provided by RefSeq, Feb 2009]

Forensic Context

A study in rats demonstrated that ultraviolet-B irradiation induced transcriptional changes in dorsal root ganglia, where the NPTX2 was significantly up-regulated with a fold change of 1.7, indicating its association with neuronal responses in an inflammatory pain model [Dawes et al. DOI:10.1371/journal.pone.0093338]. A study in rats and mice demonstrated that the NPTX2 mRNA is up-regulated in the cerebral cortex 24 hours after experimental traumatic brain injury (TBI) [Dash et al. DOI:10.23/B:NERE.0000023614.30084.eb].