Basic Information

Symbol
NPY1R
RNA class
mRNA
Alias
Neuropeptide Y Receptor Y1 NPYR Neuropeptide Y Receptor Type 1 NPY1-R NPYY1
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_000909.6
Sequence length
2762.0 nt
GC content
0.3635

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-634.90 kcal/mol
Thermodynamic ensemble
Free energy: -695.62 kcal/mol
Frequency: 0.0000
Diversity: 726.65
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....((((((((.(((((((.((.....((((...(((((((((.((((....((((.((((((....(((((.(((....))).))))).(((...(((((..(((.....))))))))...)))..))))))))))....))))......((((..........))))..))))))...)))....)))).....))..))))))).))......(((((((......((((((..(((((((...........((((((.((((((.((((((..........(((((((................((((........))))(((((((.((((((((.(((....(..((.(.(((.((((((..(((...))).)))))).)))).))..)....)))...))))))).)..)))))))(((((((((((..(((.(((..(((((((.(((((((((.........((((.(.((((.(((..(((........)))..))).))))).)))).((((.(((((((((((((.(((((........(((((((((((.(((......(((((....)))))...))))))))).)))))(((((((........(((((.(((.......)))...........(((((((((...(((((((((((.......(((....))).............(((((((((.(((((((((((..((....(((((((............((((((........(((.........)))......))))))...(((((((((((((((....((((((.....(((((..((((.(((((((((((......))).))))).......(((...)))(((((((...((((((........((((((...((((.....(((((((((.............................))))))))).....)))).....))))))...........)))))).)))))))...........(((.(((((((...(((.............(((((((((......).)))))))))))...)).)))))...)))..))))))).........)))))...))))))))))))).)))))))))))))))....)).)))))))))..)).))).))))))))))))))))).......((((.(((..((((((...))))))....)))))))......))))))))).))))).......))))))).............((.(((((((.(((.((((......)))).))))))).))).)))))))))))....((((.....))))..)).)))))))..))))....................))).)))))).))))................)))..)))...))).))))).))))))(((((......))))))))))))................((((((((.....)))))))))))))).))))))...((((((((((((......)))))......(((..((((((((.(((.(((.......))).))).))))))))..)))(((...(((..((((((((..(((((............((((((((....((((((......(((..((((.((((((....)))))).))))..)))....))))))...))))))))..........)))))..))))))))..)))))).........))))))).))))))...........)))))))..))))))...(((((.((((.(((((((((((..........))).)))......))))).)))))))))....)))))))((((((((((....((((((((...((((..((((((....))))))....))))..))))))))...(((((((.(((((((((((((((.....((((((..(((((.((.((((....(((....)))..)))).)).))))).))))))...)))))))))))))))((((((((...((((((.(((.(..(((((((((((((...))).((((..(((((..((..((...))..))..)))))..((((...)))).)))).......((.((((...((((((.(((((((((..(((((.......))))).......)))))))))...)))))).....)))).))....))))))))))..).))).))).)))...))))..))))..((((((((((((.....((((...((((.((((((....(((((...))))).......)))))).))))...))))...)))))......(.((((((..........)))..)))).........)))))))..)))))))((((((.((((((((..(((.........((.((((.................)))))).........)))..))..)))))))))))).....(((((.(((((....((((..(((((.....((.((((((((.((((...(((..(((((((((..((((..........))))....))).))))))..))).)))))))).)))).))......)))))..))))))))).)))))....(((((..((((.......)))))))))....((((((((((.((((......)))).))))))))))..))))))))))...))))))
Thermodynamic Ensemble Prediction
..(((((((((({.(((((((.{(,....((((..,(((((((({.((((....(((,{((((((....{((((.(((....))).))))}.(((...(((((..(((.....))))))))...)))..))))))))))....))))......((((..........)))}..))))))...))}.}..)))).....))..))))))).||,,...((({{((((((..(((,((..{(((.(((((((({.........(({((((((.(((((({{{{{{{{{.,,((((({,...,,|||}}.}}.((((........)))).,{{{.({{,{{...))))),}}})))))))))((,{((((((((,(,..(((.((({..........{(((((,,,,,..||||}||.|{.{{,{{{,{((((.((((((..,.((((.(((.(((((((((((.....(((((((((((.(,((((.(((..((({{...,}.})).,))).))))}.))||{(((((((.,((((((.{{(({{{....,,...,,|||.,{,....,||,,{{,|{{{{...,))}}},,,)))})))))),.)))))))},.}))))))))(((..(((.......)))..)))......(((((((((...(((((((((((,...,,.,{{...,||,..}},......,.{((((((((.(((((((((((..{{....(((((((,..,..,.{{{,,((({,........(((.........)))...,}.))))}}.,,{((((((((((((((...,((((((.,{,,({({(..{{{|.||{{{,,{,((,,,{{,|||,|||||{{.....{{{||,|||(((((({...((((((,,,.....((((((.,,((((.....(((((((((........,,.........,.........))))))))).....)))).....)))))).......,},,)))))).))))))).,..,,,|,..|((.((((({{...((,.,,,.........((((((({(......}.)))))))))))...)),)))))...},,,,))}}}}}.....,,,.))))),,.))))))))))))).)))))))))))))))....}}.)))))))))..}).))).))))))))))))))))).......{(((.(((..((((((...))))))....})}))))......))))))))).,{{,{{........|,,|..,,))},.(((((....))))).)))))))))))..)))..)))).,)))).)).)))).}))}||{{||}|,..,,,,,,,}))))),}..,}}.,{{..,,.{{,......((((.{,....)),)}}}..,,,......}}}.......}}}).))).,.)),..)))))))))))((((....,}}),|||,,,,,))}.........,,....((((((((.....)))))))))))))).)))))))}....(((.((((,..}}}}))),,((........))..}))))))))}))}..,,...)))..)))}})},..}}})))||,{{{{({{||{{,((((((...((((((((,.....((((((((((((((((((...,,,.((({(((..{(((({....}))))}.,{{{({(,,,((((,,..,,||||...||||}},,,,..,,,{|,|||,,})}}}}...{{{{{||,,|||.||{,,..,||,||(.(((((({(((..{{{{.,,|..,}}}.}}}})))}..})),})),)}},,,,.|||.,|||||.}}}}}}}},,,}))}{(((((....))))))}}}}||}.,,,,.}},.(((((.((((({......((((((....)))))).(((((((((((((.(((((((({.{({{(((((((((((((((,,...((((({..,,,,(((((.(.......).)))))....|,...}},.||||.}))}}).,.)))))))))))))))}}),,.,{{({(.,{{.{,........,,)},,.||{|...}))}}}}},,,,,.,.,)))))))))......)))))))))))))))))))).)))))..,,)))))))))))))))..((((((((({,,{{{{{{|||{|{,{{,,,...||})|},},,}}}}})))))))))))))))))))))))...)))))).......,(({{{((((((((((,,{(({,.{{,...,||||,.....((((...((((.((((({..,.{{(({...})))}.......)))))).))))...)))){(((({{,,.{{{{{,({{{{{..........|},.,{,{{.,,.......}}|{{{.((((....((((((.((((((((..(((......,,.((.((((.................)))))).,,......)))..))..}))))))))))).....)))).})}}}}}},}}}}}}}}.,,,..)))))))..,}},})))))))))))})|{((({,,,,,|{||.,....,{|{|}}|....,,,.)))))}.}}))}}))}}.}}.,,}}}},...,...}))))))))).....,,(({{....,,))},....((((.((((((..(((.((({{(((((((((,(((,......}))).))))))))))))))))...)))))).)))).

Transcripts

ID Sequence Length GC content
AAUCUUUAGGAUCUGAGCAGGAGAAAUACCAGCGGAUCUUCCCCACUCU… 2762 nt 0.3635
Summary

This gene belongs to the G-protein-coupled receptor superfamily. The encoded transmembrane protein mediates the function of neuropeptide Y (NPY), a neurotransmitter, and peptide YY (PYY), a gastrointestinal hormone. The encoded receptor undergoes fast agonist-induced internalization through clathrin-coated pits and is subsequently recycled back to the cell membrane. Activation of Y1 receptors may result in mobilization of intracellular calcium and inhibition of adenylate cyclase activity. [provided by RefSeq, Aug 2013]

Forensic Context

A study in rats demonstrated that the NPY1R mRNA was up-regulated in the frontal cortex of ethanol-naive, alcohol-preferring AA rats compared to alcohol-avoiding ANA rats in DNA macroarray analysis, though this finding was not confirmed by subsequent RT-PCR validation [Worst et al. DOI:10.1002/Jnr.20496]. A study in mice selectively bred for high or low methamphetamine intake identified the NPY1R as a prefrontal cortex differential wiring gene associated with cell communication, indicating its involvement in the transcriptomic networks underlying innate risk for addiction [Hitzemann et al. DOI:10.3390/brainsci9070155].