Basic Information

Symbol
NR1D1
RNA class
mRNA
Alias
Nuclear Receptor Subfamily 1 Group D Member 1 Rev-ErbAalpha REVERBalpha REVERBA Ear-1 THRA1 THRAL HRev V-ErbA-Related Protein 1 Rev-ErbA-Alpha EAR1 Nuclear Receptor Subfamily 1, Group D, Member 1 Nuclear Receptor Rev-ErbA-Alpha EAR-1 HREV
Location (GRCh38)
Forensic tag(s)
Time since deposition estimation Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_021724.5
Sequence length
2630.0 nt
GC content
0.5886

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-929.90 kcal/mol
Thermodynamic ensemble
Free energy: -973.71 kcal/mol
Frequency: 0.0000
Diversity: 667.67
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((........((((((.((((....(((.((((((.((..((((......))))..)))))))).)))..))))...............(((((((.((((..((((.......))))...)))))))))))(((((.(...(((.........)))...))))))))))))...((((((.....((((.(((((((...(((..((.((.((((.....)))).))..........((((((..................((((((............))))))....(((((...)))))....(((((.(.((((((((...((......))....)).)))))).).)))))((((..(((....)))..)))).((((((......))))))..)))))).((((..((((((((...(((((((..((.......((((.(((....((((..........))))...)))))))(((((.....(((((.(((((................)))).).))))))))))......((((...((((((........))))))...))))..............(((....))).....((((((((...(((...)))...))))))))(((.((((((.......((((.....(((((((.............((((.(((((....))))).........)))).(((.(((((((((.......................))))))))))))................))))))).....))))......))))))...)))(((((((((((..((.((((..((((..(((((.((((.....(((((.(((....))).)))))..(((......)))(((.((((((...((...(((..........((((....)))).((((((((((...(((...((((((.(((.(((((((((((................(((((..((.((..(((.....)))..)).)).)))))....(((.(((((((.........(((((....)))))((((((..((((.((((((((((((((...)))))))))).)))).))))...)))))).))))))).))))))))).))))).....((((......))))((((.....)))).(((.....)))))).)))))).....)))...))))...........(((((...)))))))))))..)))...))....)))))).)))....((((((.(((((((((((........))))).(((((..((.(((((((....(((......)))))).)))).)).......)))))((((((((......((((((...((((..(((..(((((..(((((((((((....(((((.......))))).....(((...((((((((((((((..............))))).......)))))))))....))).....................))))))))))))))))...(((((((....((((....))))((((((.(((((....((((((.(((.((((.((((..(((((...(((.((((............))))...(((((.......))))).......)))..)))))..)))).)))).)))...(((....)))...(((((((((((..........)))))))))))((((...))))..(((((....)))))(.(((((((((((...(((.((((((((((....)))..))))).)).)))...))))))))))))))))))(((((.....))))).........((((((((((((.(((......((...(((((((...(((((...((((((((((((...))))))...(((((((....((((.(((.((((...)))).)))..((((....))))...)))))))))))....))))))))))).)))))))))...))))))))))).))))...(((((((.(((.((((((.....)))).)))))....)))))))....))))))))))))))))))......)))..))))...)))))).......))))))))..)))))).))))))..(((((((((((((.....)).))))))(((((.((((((((..(((((........)))))..))))))))...))))).)))))..)))).)))))..))))..)))))).((((.(.((.....)).)...))))....))))))))))).((((((((.(((...)))..))))))))...))..)).))))))))))))).))))))..)))..))))))).(((((((........)))).)))((((...((....(((((..((((((((((((.......)))))....)))))))..)))))....))...))))..))))......)))))).........................................))))))................((..((((..((..((((((..............))))))....))..).)))..))
Thermodynamic Ensemble Prediction
,{{((({,.{{,,.{{({{(,((((..{.(((.((((((.((..((((......))))..)))))))).))}.,},}}...............((((((,,((((..((((.......))))...))))))))))){{{{(.{...(((....,.{,,}}}.,,}))})}}||}||{,.((((((.....{,,,.(((((((...{({..{{.{{.((({.....}))).)).....,,}|||{{{{,..................((((((........,.,.))))))....(((((...))))).....{{{{,},}}))||{{||,{{,,{{,{,,,,..,|.}}.,})}}}}))))},.}}}|}|.,,|...,|}|}}.((((((......))))))..}}}}}}.((((..(((((((,..{(((((({..({...,.,.,({{,(((,,.,(((({{{{{{,...,|||{{.,,|||||||{{{||.,,(((({.(((((................)))).}.)))))),,}}......((((...((((((........))))))...)))).,|,....,.,...{{{|...,||,,...((((((((...(((...)))...)))))))){({,((,{,,.....,,((({,,,,,(((((((........|,...((({.(((((....))))).........}}}}.(((.(((((((((.......................))))))))))))...,,,,,........)))))}|.....)))},,,...,}))))...})){((((((((((,,{{,(((({{{,(({.,,(((,(((,,({{,(((((.(({....))).)))))}}.})))))...,}}}|,}||}}}},,,|||||||||.,{{(...,|}}{(({.|||{...|||||||||{((({{,..{{((..((((((((({,(((.,({,{..........})))))))..,..,|,|,..}}))))..)}{{.{{{{{...,(((.(((((((.,.......(((({....}))))((((((,.((((.((((((((((((((...)))))))))).)))).)))).,.)))))).))))))).)))}}}},}.))))).},,.((((......))))|,{{...,,||||((((({,,({({{{(((((.{.......,,.,}}}))...........{(({(.,{|||||{...{{{{{{..,,||||.(({......,,,.((((.((((.{,...{((((........))))),.)))}.))))......,.},}}|))))},.}))))).|||||,}..,.,,.,))))||,,||||}}}}.,((((((...((((..(((..(((((..((((((((((,....(((((.......))))).....(((...((((((((((((((..............))))).......)))))))))....))).......,............,))))))))))))))))...(((((((....((((....))))(((({{((((((....((((((.{({.((((.((((..(((((.{,,{{.((((............))))...(((((.......))))).......)))}.)))))..)))).)))).}||,..{{|},..}}}...(((((((((((..,....,..)))))))))))((({{.....}..||||{....})}})|.(((((((((((...(((.((((((((((....)))..))))).)).)))...))))))))))),)))))){{{{{|.,.,}}}}}.........((((((((((((.(({......{({,,(((((((...(((((...((((((((((((...)))))).,.((((((((({.{{,{{(((.(({,...}}}}.})}..||||,,,,})},...)))}})))))).,..))))))))))).)))))))}}..,))))))))))).))))...(((((((.({{.((((((.....)))),))})}....)))))))....))))))))))))))))))......)))..))))...)))))),|.....)),,)))).}||{|...||||||,.|)}))||{{{|||},},,),,))))}}|||||,|||||||||.|||||}},,..,,}}})))))}}))))}...))))),})))},,)))),)))))}}))))..)))))),|||{,,,|,.......,}},,})))}}..))))))))))}.((((((((.(((...)))..)))))))).,,))..)).))))))))))))).))))||,.}}}..})))))).,{{{{{{........)))|.}},{(((...((....(((((..(((((((((({(.......))))}....)))))))..)))))....))...)))),})))}......)))))}..............|,.........................}}}}}},....................|)},..,.,((((((..........,...)))))).,}}},,}}}),,....

Transcripts

ID Sequence Length GC content
AGAGUGAAAUAUUACUGCCGAGGGAACGUAGCAGGGCACACGUCUCGCC… 2630 nt 0.5886
Summary

This gene encodes a transcription factor that is a member of the nuclear receptor subfamily 1. The encoded protein is a ligand-sensitive transcription factor that negatively regulates the expression of core clock proteins. In particular this protein represses the circadian clock transcription factor aryl hydrocarbon receptor nuclear translocator-like protein 1 (ARNTL). This protein may also be involved in regulating genes that function in metabolic, inflammatory and cardiovascular processes. [provided by RefSeq, Jan 2013]

Forensic Context

A study in humans identified 11 mRNA markers with statistically significant 24-hour expression rhythms in blood, including the NR1D1, for estimating blood deposition time [Lech et al. DOI:10.1016/J.Fsigen.2015.12.008]. A study in mice demonstrated that the NR1D1 is a key characteristic gene in endothelial cells and is markedly downregulated during myocardial infarction progression, as confirmed by scRNA-seq, microarray analysis, and in vivo experiments (qPCR, WB, immunofluorescence) [Mao et al. DOI:10.1016/j.bbrc.2025.151820].