Basic Information

Symbol
NR3C1
RNA class
mRNA
Alias
Nuclear Receptor Subfamily 3 Group C Member 1 GR Glucocorticoid Receptor GRL Nuclear Receptor Subfamily 3, Group C, Member 1 (Glucocorticoid Receptor) Nuclear Receptor Subfamily 3 Group C Member 1 Variant HGR-B(54) Nuclear Receptor Subfamily 3 Group C Member 1 Variant HGR-B(77) Nuclear Receptor Subfamily 3 Group C Member 1 Variant HGR-B(93) Nuclear Receptor Subfamily 3, Group C, Member 1 GCRST GCCR GCR
Location (GRCh38)
Forensic tag(s)
Forensic psychiatry evaluation

MANE select

Transcript ID
NM_000176.3
Sequence length
6778.0 nt
GC content
0.4035

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1880.50 kcal/mol
Thermodynamic ensemble
Free energy: -2013.53 kcal/mol
Frequency: 0.0000
Diversity: 1769.57
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((.((..((((((((((((....((((((.(((..(((.(((((((((((((((.((.((.((((..((((((..((((((((.((.(((((((((((((...(((.((.(((((.(((((((....((......))....))))))).))))))))))...)))))).)))))..)).)).).))))).))..).)).)))..)))))).)).)))))).....))))))..((((..((((((........))))))...))))((((((((((.(((((((....((((((.(((((.....))))).))))))....)))).(.((((.(((((((..(.........(((((((.....))))))).........)..))))))))))).)))).))))))).)))......))).))).)))))))))...))))..)).)))))).)))))))..((((((((((((((((((((..((........))..)))).))))))).)))))))))...........(((((.....)))))...(((((((.((((((((((...(((((((.........(((((((.(((...((...((((.(((((((....((((((((((((((((((.((.............)).))))....(((((((........)))))))((.((........)).)).))))))...(((.(((...(((((((((.......))))))))).....))).)))..........))))).)))....))).((((...))))..))))))))..)).))).)))))))(((((...(((((....(((((((((.....(((((((...((((....))))....)))))))..........)))))))))(((((.....))))).)))))...))))).(((((...((((((....)))))).)))))..(((...((((((((((((.((((((.((((((...)))).))...(((((((((.....))))).))))..........(((..(((((((((((((.((((((((((.....))))))))))..(((((((((((((((((((((..((((.((.((......((.(((((.......))))).))((((((((.....))))))))....(((.((((....)))).))).(((....))))))).)))).))))))))).(((((((.(((...((........))....))).).))))))........(((((((........((((......))))....((((....((........))....)))).....)))))))..(((((((.(((..(((((((((((....))))...))(((((((((((((((((((....(((((.(((((((..((((((.(((((.((((((((...((((.((((.....)))).)))))))))))).....(((((((((..............((((.((((.(((((........(((((((...(((..(((..(((((.((.............)).))))))))..))).)))))))..((((((.....(((((.........))))))))))).(((((((((((..(((...((((.((....)).)))).)))(((((((.(..((((((.((((((((((..(((((....(((((.....((((.........(((((.((..((....)).)).)))))..........))))......)))))....)))))..))............))))..)))).)).(((((((........)))))))..))))..).))))))).((((......))))))))))))))).((((((((.(((((((((....((.((((((.(......).)))))).))))))....................((((.(((((.(((((......))..(((....)))..))))))))..))))((((((....((........))....)))))).................))))).)).))))))))))).)))).))))..((..(((((((((((((((((..((((((((((((........((((((((((.....(((((..(......)..)))))....))))))((.((((((....(((((..((..((.((((((.............))))))))..))...)).))))))))).)).)))).(((((((......)))))))..)))))))))))))))))))...((((((.(.(((((.(......).))))).).)))).)).........(((((.....)).)))...))))))))))..))............))))))))).((((((((.....(((..(((((.((((...(((((.((((...)))).)))))..)))).....(((..((((((((..((.......)).))))))))..)))((((.(((((((....(((......)))))))))).)))).....)))))..)))..))))))))(((...)))...))))).))))))..)))))))...((((((....(((((((((((((.((((.(((((((((........)))))))))...((((((....))))))......)))).)))..))))...))))))))))))((((.((((((.............(((((((..((.(((((((((..(((((((((.((......)).))))((((..(((..((((.........)))))))..))))(((.(((((((((((((.(.(((((((...))))))).).))))))))..))))).)))..)))))..))))))))).)).)))))))..........(((((....(((((((....(((((((.((((((((..........))))))))...((((((....))))))((((..(((...(.(((......))).)...))).))))............((((....((((((.(....))))))).......)))).)))).)))))))))).))))).....((((((((((.((((..((((.((..((((((((((((((..(((((((........))))).))..)))).((.....))...((.(((((((((((((......)))))).))))))).))......))))))))))...((((((((..(((..((((((((((((((((....((((......))))..)))....)))))))))).....)))..)))..)))))))).((((((((..((((((.......(((.(((((((((((..((..(((((...((((.(((((.....)))))..))))..))))).))..))((((((((((.....((((((((((((((((((.(((((.....((((((.....)))))))))))))))......(((((...................)))))...............(((.(((.((((((.(((((.........((((((.(((..((((((((........)))).))))(((((..(((.....)))..))))).......((((((((...(((.((.(((((......)))))...........(((((((((((((.((((............(((...(((((((.(((....))).)))))))....)))...............)))).)))))))..))))))..((((((((.....))))))))............(((((((...)))))))(((((((((.........))))).....)))))))))...)))))))).....))).)))))))))))))))))))))))....))))))))))))))...............))))))))))((((((((......)))))))).((((...))))..((((((.((..(((((.((((.((.((((....((.((((....)))).)).....)))).)).)))).)))))))))))))....(((((....)))))((((((((....)))).)))).....(((((((((((((((((((.........(((..(((..(((((((..............(((((..((....(((((......(((((.......)))))))))).....))..))))).))))))).((((((..((((...((((((((((..........))))))))))...))))......))))))...........((((((....)))))).)))..))))))))))))))))))))))...(((((((.........))))))).))))))))).)))))))))...))))))))......)).))))..)))).....((((.(.(((((.......))))).))))).....((((..(((.((((.(((((.....))))).)))).)))))))))))))))))...)))))).))))..)))))...))))))))))))(.(((.(((((((.((((((((.(((((((((((.(((((((((((.((......)))))))).....(((((((.....))))))).................)))))(((((.....)))))..))))..))))))).)))))...))).)))))))))).)......((((((((((((.((....((((.......(((((((((((..........)))))))))))......((((...(((((..(((((((((((((((...((((.....))))((((((((..((((((((((((....))))....(((((((((((.(((....))).)))..(((((...)))))(((....((((((((((((((((.................((((((....))))))..(((((((......)))))))...(((((((....(((((........)))))..)))))))((((((...(((((((....(((.(((....))).)))))))))).)))))).))))))))..............)))))))).....)))............))))))))......(((((((((.((....)))))).).))))..)))))))).....))))))))...((((((.....(((((.......)))))))))))..(((((((((((..(((((...((((((..(((......(((((((((....((((....((((...............))))...)))).((((((.((((((((((((((........(((....))).......))))))....(((((((...(((...((((((((.(((.((((.(((((...(....)..)))))......(((((....((((((....))))))..))))).((((((((...))))))))........)))).))).))))))))....)))......)))).))).....((((((.....)))))).......(((((.((..((((........))))...)))))))((((..(((((((((((((((((((((....))))))).)))))))...))))))).)))).((((((((..((((((((((...............((((......))))..............))))))))))...............))))))))..))))))).).))))))....))))))))).....(((...((.....))...)))(((.(((((.(((....(((...(((((((.....((((((......((((((((...((((((.......))))))...(((((..((.....(((((((((((.....((((((...))))))))))..((((.........)))).)))))))))..))))))))))))).......))))))...))))))).)))...))).))).)).))))))..))))))))))).)))))))))))......(((((.....(((((((.......)))))))...))))))))).))))....((((..((((((((.((((((....(((((((((.((.........)))))))))))....(((.((((.....)))).))).)))))))))))...)))..))))((((....))))))))))))))))..))))))))......)).)))))...))))))).......((((((.(((.........))))))))).((((((((((((((((......))))).........))))))))))).....))))))).....(((.((((((.((((............)))))))))).)))..)))))..))).))))))).........((((((.((.(((((((...))))))).)).)))))).............)))))))))))).....))))))))))))).)))........(((.(((((((.........))))))).)))))))))))))))))))))...)))......(((....)))......(((((((((((((.....))))))).....)))))).)))))))...)))))).........)))).))))))).
Thermodynamic Ensemble Prediction
(((({,{(,.((((((((((((..{,((((((.(((..(((.(({((((((((((((.((.((.((((..((((((..((((((((.((.(((((((((((((,{{(((.((.(((((.(((((((,{..((......)).,,.))))))).)))))))))).}})))))),,))))..)).)).),})))).))..)}}).)))..)))))).)).)))))).....))))))..((((,.((((((........)))))).,,))))((((((((((.(((((((....((((((.(((((.....))))).))))))....)))}.(.(({{((((((((..{.........{((((((.....))))))}.........,..))))))))))).)))).))))))),,}}......,)).))).))))))))}.},))))..)).)))))).)))))))..((((((((((((((((((((..((........))..)))).)))))))},))))))))..,,....,..(((((...,,|}}}|..|{{(((((,(((((((({(...{(({{{{....,,,..{{{{(({,{{,.,|{,,..|{|||{{||{||,,..|||||{(((((((({(({,((......},.....,},}||}.,,.(((((((........))))))){|},,,,..}}..,),)).))))))}|.(((.(((...(((((((((.......))))))))).....))).))),.........,||}},|||....}}}.{{{{...))))..))|||||,.....,))}))}}}}}(((((...(((((....{((((((((.....,((((((...((((....))))....))))))},....,....)))))))))(((((.....))))).)))))...))))).{((((...((((((....)))))).))))|,,(({,,,((((((((((((.((((((,((((({...}))).))...((({(((((.....))))).}))){{{,......(((..(((((((((((((.((((((((((....,))))))))))..(((((((((((({..{.((((((((((((((((((((((((((.{.((.({{,..(((((((((((((((.....))))))}|,{({(((.((((....)))).)))..}}|{,{((((,,,...,||}|}}}}}},.(((((((.(((...((........))....))).).)))))).,,||,..((((((({..(((..,{,((({{{{,|||....((((....((.,....}.))....))))}}}..,)))))),.....))}.,,...||||}}},|||,,,.))}}{{{{,..,,.,|)))}}}))))}}}....(((({,,,...,,..|}})}.{{{(({((((({{({{.((((.((((.....)))).))))))),}},,))}))},,,,},,....}})))}.,))))))).}},{{,......,,,...(((((((...(((..(((..(((((.((.............)).))))))))..))).)))))))...}}}..)))))))))))))).}.,((((((((.(((((.(((((((((...((((.....))))......,(((((({(((((((.(..((((((.((((((((,{{..,(((..({.((((.....{............|||),})}}}||}}.,}|.||{|||||{,...,,..}))))},},...|||.(((((((....)))}}})..}},..))))..)))).)),(((((((........)))))))..})))..).))))))).((((......))))........((((((((((((((.((((.(((({{((.((((((.{......,.)))))),||.,||{,{(({..(({{{.{((((((({((..(((((((((.((((((({.,,{,...{|,,{{{|{|{{.....,{((((((....{{........|}....))))))|,,...((((........))))....}}))))|||||.,,||||||{{{{({{(((((,,,,,)}})}}},,.{{{{,,,}))},,.{((((((((((.((({,,..(({{{.,(,,..,,|,,|}}|}((((,.,.))}).((((((....(((((..((,,{{.((((((...{{...,,...))))))}),.))...)).))))))))).}}.}}}}}|{|||||......|||}},,)}}..(((((((((.((((....,,...{,.{,(({.,..}}}.,,,|||{((((.{{{{......}}},..))))))),.)))))))))))))((((((,..{{....))....)))))).})))).,))))))))))}....,|||}}}||||.|,{{{{{.((((...)))).}}}}}..,,},,,,,,|||,.((((((((..((.......)).))))))))..|||((((,((((((({{{.{(({,...{{{{},||,,.,)},)})).{(((((.((((({.,..((..(((...)))..)).....)))))).)))))).{((.((((((...{((,,((((((.(({({((.(((((((((........))))))))).,.((((({....})))))......)))}.))),.)))),}},,))),)))))).))}....,,,........|||,,{{..,{|..,...|||,,,||,.......,|}}})}))}}})),},,|((((..(((..((((.........))))}))..))))|....,|||||||||,,.,.{((((({...)))))))))))))).)))}})))))..)).})))))))).))))).}.))}),)))}),,,.......(((((....(((((((,...{((((((.((((((((..,....,..))))))))..{((((((....))))))|(({..{((,,({{{({...}))))}.,,,.,,..)))},...........((((....((((((.{....})))))).......)))).)))).)))))))))).))))).....{{{{{{(((((((((..((((.((..((((((((((((((..(((((((........))))).))..)))}.((......},,.{(.(((((((((((((......))))))}}}))))).))......))))))))))...((((((((..(((.,((((((((((((((((....((((......))))..)))....)))))))))))}...}))..)))..)))))))).((((((((..((((((.......{{{.{{{{{{((({((((({(((((,,,,((((.(((((.....)))))..)))}...,,,,.,,....{,{{{{{{{,.....((((((((((((((((((.((((,...,(((((((.....)))))))))))))))......{((((..............,,...))))}...............(((.{((,({{{{{,{{||{,,||,....{(((({.,{{..((((((((........)))).))))(((((..(((.....)))..))))).......((((((((.,,(((,,,,(((((......))))}...........{((((((((((((.((((...{,,,.....(((,,.(((((((.{((....))).))))))),},.))}....,,...|.,...)))).)))))))..)))))}..{{((((({.....)))))))),...}},,....{((((((...))))))|{((((((({.........}}))).....)))))}},,...)))))))).....,,,.)))))},},}|}))}}}})))))....))))))))))))))...,,..|,....,.}}}))}},,,((((((((......)))))))).{{{{...))))..,(((((.,,,,(((((.((((.((,((({...,||,||{,....|||||||.....)))),)).)))).))))))})))))}....(((({....})))){{({{{{{....|})},}})).....(((((((((((((((((((({...,...,,,,,{{,..,{{{{({..............{((((..{{....(((((..,.,,({{{{...,...}}}}}))))).....}}..))))).}}}}}}|.((({{{..((((,,.((((((((((,.....,...}))))))))),,.))))...,,,))))}|,,..,,,{{{.,{||||,,..}}},}}.)))..,)))))))))))))))))))))...{{(((((.......,,))))))),))))))))),)))))))))...))))))))......)).))))..))))})))))|}),......}}}})))}.)))).))).......}}}))}(((.{(((.(((((.....))))).)))).))),....,.....)))))...))))))))))))..)))).)))))..))))))))||.(((((((,((((((({.(((((((((((.{,{{{|{{|{(,((,{,{.{|,,,))|}|}...(((((((.....))))))),}}}.....,,,,.,..,,,,|(((({.....)))))).)))),,))))))).))))),,.))).)))))))}|(({(........}}}},,|,,,.((((((((((.({((.(((((((((((..........)))))))))))....{.((((,,.{((,.{{(((((((((((((({,..((((.....)))){(((((((..{{{{{(((((({{.{{(({{{{{.,{{(....||,.|||}}}})),.}|},|,,|||}.,|||}}||||,..,{((((({,{{{{{{{,,...,,....,.{{{{{{(({{,,,.,,,,,|,.(((((((......))))))),}}|{{,{{{,,||{{{{{{{,..,{,|||,|{{,,,.|{{((((((...((((({{..,,{{{.{{,...,))}.}}}))))))).)))))))))},)))}}}}}},..,,,..,}|||}}}}.},|,|||,|||.....,,})}}})))},.,,..{||{{((({,({....}})))}.}.}}}),}}}}}}|}}.....))))))}}...{{{{{{.....(((((......,)))))}))}}},,{((((((((((..(((((,..((((((..{({{({,(((((,(((({,..,{{{{||,{({{........,...,,..|)))....,|,}||||||,,{{,{{{|(((({(.,......{{|..,.))).,.,}}.))}}}),,,.||,|{((((((.{,..,,||}}},}},,,}}||}||{,...}|}||,|||||||||...,,|||||,,{,((((((....)))))).}))),,.((((((((...)))))))){{,{{..,})))}},,.||||||||||||{|,|,.,,.{((({(((({...({((((...,,||||}}....,||||||(,{{,.(({{....,.,.)}}}...}}|||||{|,,.,}|||||(((((((((((((((....))))))).)))))))}..,}}}}|{{{{{{.((((((({..((((((((((........,,...,.(({{......}))},||......}}...))))))))))............,..))))))))..,))))))},.....,,.,,.))))))),))),,||||}}}||}|,.|}|}|||||{{(,(((((.(((....(((...(((((((.....((((((......((((((((,..{{((((.......})))},...{((((..(({....{((((((,,{{.....((((((...)))))),,}|..{{{{.........))}}.)))))))))..))))))))))))).......))))))...))))))).)))...))).))).)).))))}},,))))))}))))}))))))))))}.,,,,||((((...,.{((((((.......)))))))...))))))))).))))....((((..((((((((.((((((..,.(((((((({{((.........)))))))))))....(({,(({,....}))}),)}}.)))))))))))...)))..))))((((....)))))))))))))}}}..)))).,.......,,||||||,...,{{({(({{{....,||{{,...||||}|,,,..})})}.,..((((((((((({((({......}}},}......,,,))))))))))).....{{{|....}}}.{((.((((((.((((............)))))))))).))}..}}.,),.))))))))))...,,,..,,,{{{((.{|.(((((({...))))))).}}.)))))},,..........})))))))))))).....))))))))))))).)))......,,}}{{(((((,{.........,)},)))})))))))))))))))))))||,..}}}............,})}.,,...(((((((((((((.....))))))).....)))))).}}))))),.,)))))}..........})),))))))).

Transcripts

ID Sequence Length GC content
ACAAGCUAAGUUGUUUAUCUCGGCUGCGGCGGGAACUGCGGACGGUGGC… 6985 nt 0.4142
Showing 21 to 21 of 21 entries
Summary

This gene encodes glucocorticoid receptor , which can function both as a transcription factor that binds to glucocorticoid response elements in the promoters of glucocorticoid responsive genes to activate their transcription, and as a regulator of other transcription factors. This receptor is typically found in the cytoplasm, but upon ligand binding, is transported into the nucleus. It is involved in inflammatory responses, cellular proliferation, and differentiation in target tissues. Mutations in this gene are associated with generalized glucocorticoid resistance. Alternative splicing of this gene results in transcript variants encoding either the same or different isoforms. Additional isoforms resulting from the use of alternate in-frame translation initiation sites have also been described, and shown to be functional, displaying diverse cytoplasm-to-nucleus trafficking patterns and distinct transcriptional activities (PMID:15866175). [provided by RefSeq, Feb 2011]

Forensic Context

A study in humans identified a haplotype within the FKBP5 gene associated with increased risk of suicide attempt (OR=1.58) in live subjects [Yin et al. DOI:10.1002/da.22499]. A study in mice demonstrated that the glucocorticoid receptor, a mammalian intracellular receptor, serves as an example of ligand-dependent action [Shostak et al. DOI:10.1101/gad.1218504].