Basic Information

Symbol
NRAS
RNA class
mRNA
Alias
NRAS Proto-Oncogene, GTPase N-Ras Neuroblastoma RAS Viral (V-Ras) Oncogene Homolog Neuroblastoma RAS Viral Oncogene Homolog Transforming Protein N-Ras GTPase NRas V-Ras Neuroblastoma RAS Viral Oncogene Homolog Proto-Oncogene GTPase N-Ras Protein Part 4 EC 3.6.5.2 ALPS4 NRAS1 HRAS1 CMNS KRAS NCMS NS6
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses Forensic psychiatry evaluation

MANE select

Transcript ID
NM_002524.5
Sequence length
4326.0 nt
GC content
0.3742

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1134.47 kcal/mol
Thermodynamic ensemble
Free energy: -1218.93 kcal/mol
Frequency: 0.0000
Diversity: 1143.73
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((((.((((((((((....)))))).......)))).))))))...)))).(((..((((((((.....(((((....((((.....))))((((((((((((((..........(((((((((.((((.((((((((((.(((.(((.((((((..((((..((((((...((((((((((((..(((((((.((((((((((((((.((...((.....((((((......).)))))....))....))))))))))((((((((......))))))))........))))))..)))))))........)).))))))..(((..(.(.((((((((((((..(((....)))))))).))))))).))..)))......((((.....))))..........((((....))))...((((..(((((.....)))))..))))(((((...)))))(((.(((((((((((((.(.(((((.....)).))).).)))).....((((((..((((.((((....(((..(((.(((........))).))).))).(((((((..(((.((((.((((...))))..)))).)))...((((((....(((.(((.((.(((((.(((((.(((((((((((((((((((((((((((.....((((((((((....)))))))(((((((((.((((...))))..((((((.....(((.........)))...))))))..((((((..(((..((..(((((((.(((((((((((.((((....))))...))))((.(((....))).)).....((((((((((((.(((......)))...))).))))).))))....)))).)))..)))))).)..))..))).))))))..........))))))))).)))............)))))))))))).....((((...........(((......)))(((((((....))))))).((((...((((...)))))))).....(((....)))...(((((.....(((((((....(((....((((((((....)))....)))))....)))....))))))).....)))))...)))).((((((((.(((((((........)).))))).))))))))...))))))))))))))).))))).)))))..)).))).)))....)))))).....(((((((((((((((((((.((((.((...........)).)))))))))))...((((.((((((...............................))))))..........))))((((((..(((((..(((((..........(((((((..((((((((.((......((((.((((.......)))).)))).......)).)))..)))))))))))))))))..))))).)))))).))))))))))))((((((((....))))))))))))))).....)))).))))..)))))).....(((((.((.(((((...........((((....)))).........))))).))..))))).........((((((....))))))(((.....)))...)))))))))))))))).)))))).))))....))))))..))).)))))))))))))...)))).))))))))).))))))))).(((((((((......)).)))))))......(((((((((((.......((((((((((((((.............(((((...)))))..............))))))...))))))))....))))))))))).....)))))...............((((.(((((((.(((.......(((((..((((.((((((((........((((((((((((((((((((((((....(.(((.((((....))))))).)..)))).)))))))))..(((((.....))))).))).))))))))(((((....(((((.((((((.(..........).)))))).)))))....)))))(((((((.(((((((((...((((((((((..((((((..((((...(((((((....(((((((((((.((((....(((((.....((.((((((((............(((((((((((....))))))))))).((((((.......((((((((..(((((((..............))))))))))))))).((((........)))).)))))).)))))).)))).....)))))..)))).))))((((((((((((((....................((((((((((...(((.((((((........)))...)))...)))...))))))))))..........(((((....((((.....)))).....))))).........)))))))))))))).......))))))).)))))))....)))).............((((((((((((.....(((((((..(((.(((..((((((((((((((((((((.((((.(((.((..(((.((.......))))))).))))))).))))).)).))...))))))...)))))..))).)))...)))))))))))))))))))(((......((..(((((((....))))))).))......))).......(((((.......)))))(((((((((((...((((.((((((..(((.(((((((.((((((((.....((((....(((((....))))))))))))))))).)))))))((((..(((((.(((...))).)))))..).))).((((((((.((....)).)))))))).)))..)))))).)))).........(((((((((((.(((((.(((..(((((..........)))))..))).......(((((((((....)))))))))..(((.(((((........))))).))).((((.....)))).(((((((...(((((....(((((.(((.......))))))))..))))).)))))))((((((.....))))))....................))))).)))))))))))..)))))))))))....(((((.(.....((((((....))))))..).)))))..))))))....)))....)))))))...))))).........................)))).)))))))...)))))))).))))....))))).......((((.(((((((((((((.......(((((..((((.(((((((..((((((((((((.(.(((((.(((......)))(((...(((((((...(........)...))))))))))...(((((((((((((.(((........)))......(((((((((((.((((((...))))))))))))))))).........))))...)))))))))...((((((..............)))))).(((((.(((((.....((((((((..(((....((.(((((((((.((.((......)).)).))))))))))).....(((((.(((((......)))))...)))))...)))..))))))))......))))).)))))...........((((.....))))...(((((((((((((((((.((........)).))))))))))))).))))...))))).).))))))))))))..(((((((((.......))))))))).))))))).))))......(((((((.(((((((....)))))))..((((((....(((((((.((..((((..........((((((((............))))))))))))..)))))))))..)))))).........)))))))........))))).......)))).)))).)))))))))........))).))))))).)))))))))..))).))))).)))...((..(((((((....((((..........)))))))))))..))(((....)))((.((((.((((((((.......(((((((((((.......))))))))...........(((((.((((...)))).)))))(((((.((((......)))).)))))...((((((.....((((((...)))))).....)))))).)))))))))))..)))).))...
Thermodynamic Ensemble Prediction
((((((((((.((((((((((....)))))).......)))).)))))){{.||}}.,,,..,{{{{{((({,{{({(({...,{(|({{|.,||{{{((({(((((((({,,,..,},,.(((((((((.((((.((((((((((.(((.(((.((((((..((((..((((((....,{,(((((({(..(((((((.(((((((((((({{{((...{{.....((((((......).)))))..,.}}....)))))))))){{((({(({...,})}}))}}}.,,,,...))))))..)))))))........)).)))))),.{{{,.{.{,((((((((((((..(((....)))))))).))))))}.}|..}}}.,,...(((({...,)))),,.|||,..,{,,{,.{{||,{{{.{(((..(((((.....)))))..))))||{||,..))}(((((.(((((((((((((.(.(((((.....)).))).).)))).....((((((..((((.((((..{,(({..(((,{{{...,,.,|}|}.}}),,},,,{,((({,.{{{.((((.((((....}))},)))).)))}}.((((((....(((.(((,,,.(((((.(((((.((((((((((((({,((((((((((((.{.,,((((((((({....}))))),(((((((((.{({,...,})}..((((((.....(((.........)))...))))))..((((((..(((..((..(((((((.(((((((((((.((((....))))...)))){{.(((....))).}}.....{(((((((((((.,{{......}},...)))}}})))},))}....)))),,))..)))))).)..))..))).)))))).,........))))))))),)))............))))))))))))......{{,...........{((......}}}(((((((....))))))).{(((.,,({{{...))))))}}.....{{{....)))...{((((.....(((((((....(((....{{({((((....)))}.,.,,}},....}))....))))))).....))))}...,|||,((((((((.(((((((........)).))))).)))))))).}}))))))))))))))).))))).)))))..,).))).)))....))))))....((((((((((((((((((((.((((.((...........)).)))}))))))),....,({(,,,,,.....,||,.............,{,,|,..,|}}}})......,,,.,},)|||{||..(((((..(((((..........(((((((..((((((((.((......((((.((((.......)))).)))).....,.)).)))..)))))))))))))))))..))))).}}}}}}.))))))))))))){{{{(({....})))))},|||,,},}},..)))).)))).,)))))).....(((((.((.(((((.,..,,,....((((....)))),,,......))))).))..))))).........{(((((....)))))|{{{.....}}}...)))))))))))))),..)))))}.))))....)))))).,})).)))))))))))))...))}}.))))))))),})))))))).{(((((({({{....))}))))))}...,{{(((((({((((....||,|{{((({{{{((((.............,{{{{.,,||}|,.......,,,....}))))),,.|||||||},...,,))))))))}...,,|||||,.......,,,,,..{{,,.{((((((.,(({......,,|||..||||,|{((((,,...,,,..((((((((((,(((((((((((((....,.(((.((((....))))))).}..)))).)))))))))..(((((.....})))),))).)))))))){((((....(((((.(((((({(,....,}},.,.}))))).)))))....))))}||{{|||.{|||{||{{,,,|||{{{{{{{..||{{{||,((((..,(((((((,.,,(((({{{,{{{.,{{,.{{{(({,,.,,.,,,{{{({{{{|,.....,,{{,.(((((((((((....))))))))))).((((((.,|,...(((((((({,((({{{{...,..........))))))))))))))).{(((........)))).)))))){|||,,,.)))}.,,{||||||,.}},}.||||((((((((((((((....................((((((((((...(((.{{,(((........)))...,,,...)))...))))))))))..........(((((....{(((....,))),.....))))).........)))))))))))))),}}},..,,}}}}}.}}}}|||{...}}},,||||,......{((((((((({{(.....{{{{{{{,.{{{.{{{..{||||||{{{{{{||||{{{.((({,(({,({,.{{{,{{,,..,,.}})})||,|||||}|,}}}}}.,,,)),,))))))),,.)))))..))).))}.,.)))))))))))))))}))).,|.,,,}}}},.(((((((....))))))){||..,...))}......|{{{||,,.....}}}|||{(((,,,,,....,|||,||||||}}|}|,((((((((((((((((.......{{,,,.{{{||,,..}}}}))}))))))))))..)))))){{{{..(((((.(((...))).)))))..),))),,,{||{{{.{|,,..)),}})}}}}}.||||||}}|||{}|||{|,...||{((((({(((((.{((({|({,.{(((((,{||,,.,,,}||||,,|||,,,{{,,(((((((((....)))))))))..(((.(((((........))))).))).((((.....)))).(((((((...(((((....(((((.(((.......))))))))..))))).)))))))((((((.....)))))).............,{{{,{.|,,)),)))}))))|||{|||||||||||,..,{{{{,|||,..,,((((((,...||||||,,}}|||,{,,||||||,...,))}}}})))))))...))))),..,.,},}.,}}}}.,,.....,,|||||||||||},,,,}}}}}}}.}}}},..,}}}}|,,.....{(((.(((((((((((((.......(((({..{(((.(((((((..((((((((((((.(.(((((.(((......)))(((...(((((((...{.{{.....)}..))))))))))...(((((((((((((.(((........)}}......(((((((((({.(((({,...,))))}))))))))))).........)))),..}))))))))...{{{{{{..........,,,.}}}}}}.(((((.(((((....{((((((((,,(({,,,,((,(((((((((.(({((......},,))})))))))))}}..,,,,{{{{.(((((......)))))..,)))))...,}}..)))))))).}....))))).))))).........{.((((.....))))...{{{((((((((((((((.{(........)}.)))))))))))))},))}...})))).).))))))))))))..(((((((((.......))))))))).))))))).)))},,....(((((({.(({((({...,|}|||},..,,,|||}...(((((((,((..((((..........((((((((..{,....,|..}))))))))))),,)))))))))...,,,,,,,.,,}}}})))))))....,,..))))).......)))).)))).)))))))))}},...,,))).)))})))})))))))))..,,}.))|||||}},}}|||||||||||||||}|||{{{,...{||||,|{{{{||},,}}}|,,|}}}}|{||,,,.,}}}||||,,}}}}}},},((((((((.......))))))))........,,,(((((.{({{...}))).)))))(((((.{(({......)))}.)))))..,||||||.,||,|{{{{|,,,))}))),}},,))))}},))})}}}}},})))}}),},...

Transcripts

ID Sequence Length GC content
GGGGCCGGAAGUGCCGCUCCUUGGUGGGGGCUGUUCAUGGCGGUUCCGG… 4326 nt 0.3742
Summary

This is an N-ras oncogene encoding a membrane protein that shuttles between the Golgi apparatus and the plasma membrane. This shuttling is regulated through palmitoylation and depalmitoylation by the ZDHHC9-GOLGA7 complex. The encoded protein, which has intrinsic GTPase activity, is activated by a guanine nucleotide-exchange factor and inactivated by a GTPase activating protein. Mutations in this gene have been associated with somatic rectal cancer, follicular thyroid cancer, autoimmune lymphoproliferative syndrome, Noonan syndrome, and juvenile myelomonocytic leukemia. [provided by RefSeq, Jun 2011] CIViC Summary for NRAS Gene Mutations in the RAS family of proteins have frequently been observed across cancer types. The amino acid positions G12, G13 and Q61 account for the overwhelming majority of these mutations. The isoforms, despite their raw similarity, also behave very differently when expressed in non-native tissue types, likely due to differences in the C-terminal hyper-variable regions. Mis-regulation of isoform expression has been shown to be a driving event in cancer, as well as missense mutations at the three hotspots previously mentioned. While highly recurrent in cancer, targeting these RAS mutants has also been very elusive, and has not yet become common practice in the clinic.

Forensic Context

A study in mice demonstrated that chronic alcohol exposure induces significant hippocampal alterations, including decreased mitochondrial ATPase activity and increased H2S levels, alongside impaired learning ability [Du et al. DOI:10.3389/Fphar.2024.1377501].