| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGACCGGACCCGAGAGCAGAGCUGCUGUUUCGGCGCGGGUCGGCUGGCG… | 1213 nt | 0.6406 | |
| AGACCGGACCCGAGAGCAGAGCUGCUGUUUCGGCGCGGGUCGGCUGGCG… | 1210 nt | 0.6413 |
Neurogranin (NRGN) is the human homolog of the neuron-specific rat RC3/neurogranin gene. This gene encodes a postsynaptic protein kinase substrate that binds calmodulin in the absence of calcium. The NRGN gene contains four exons and three introns. The exons 1 and 2 encode the protein and exons 3 and 4 contain untranslated sequences. It is suggested that the NRGN is a direct target for thyroid hormone in human brain, and that control of expression of this gene could underlay many of the consequences of hypothyroidism on mental states during development as well as in adult subjects. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the NRGN (Nrgn) mRNA expression was significantly increased specifically in the brainstem of subjects exposed to carbon dioxide intoxication compared to controls and those subjected to asphyxia due to oxygen deficiency, identifying it as a potential diagnostic marker for differentiating these causes of death [Yatsushiro et al. DOI:10.1007/S12024-025-00981-1]. In human forensic science, the NRGN was selected as a blood-specific candidate gene from genome-wide mRNA profiling and was successfully validated by RT-PCR for its specific expression in blood samples, contributing to body fluid identification [Park et al. DOI:10.1016/j.fsigen.2012.09.001].