| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCACUUGUACAUUUCUGCAGCCGCGCGGCGAGCCAUUCGCGGCGGCUGC… | 19976 nt | 0.4372 |
This gene encodes a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation and may play a role in the development of proprioceptive neurons that sense body position. Mutations in this gene have been associated with medulloblastomas, secretory breast carcinomas and other cancers. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011] CIViC Summary for NTRK3 Gene
A bioinformatic study in adult female Wistar rats (Rattus norvegicus) identified the NTRK3 as a gene enriched in the neurotrophin signaling pathway, which is collectively regulated by time-course differentially expressed microRNAs following spinal cord injury [Liu et al. DOI:10.1097/BRS.0000000000001323].