Basic Information

Symbol
NTRK3
RNA class
mRNA
Alias
Neurotrophic Receptor Tyrosine Kinase 3 TRKC Neurotrophic Tyrosine Kinase, Receptor, Type 3 NT-3 Growth Factor Receptor EC 2.7.10.1 GP145-TrkC ETS Related Protein-Neurotrophic Receptor Tyrosine Kinase Fusion Protein Neurotrophic Tyrosine Kinase Receptor Type 3 Tyrosine Kinase Receptor C TrkC Tyrosine Kinase ETV6-NTRK3 Fusion Gp145(TrkC) EC 2.7.10 Trk-C
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_001012338.3
Sequence length
20018.0 nt
GC content
0.4370

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-6195.70 kcal/mol
Thermodynamic ensemble
Free energy: 100000.00 kcal/mol
Frequency: inf
Diversity: 0.00
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((((((......((((((((.((.(((.....)))))))))))))(((((......)))))...((((.(((((((....(((.(((((((....))))))).)))((((.....))))....((((((.((....((((((........)))))).(((((.((...)).))))).....(((((....)))))...(((((((.((...(((.((.((....)).)).))).)).).))))))..((((((((((((((..((((........))))..)))))))))....))))).((((..((((((....))))))..))))(((((((..(((..((((((((((......)))))))))))))..)))))))....)).))))))(((.((((((.(((..((((.(((.((((.(((.....)))))))))))))).))))))))))))..(((((....)))))......))))))).))))((((((((.((.....(((..(((((((................((((..((((......)))).........)))))))))))......(((((.((((...(((((.(((((((((.(((.....)))))))).((((((((((....((((((((..(((....((..((((((((((((((((((.((.........)).))(((((.............))))).(((((((((((((((((((((.(((((((((((.((((.((((.((((..(((((((((.((..(((....)))..)).)))))))))..))))..)))).))))))))).)))))).(((((((((..(((.((.(((((((........))).......)))).)))))....)))))))))..(((((.(((.(.((((..((......))..))))).)))))).)))))))((((...)))).(((((..(((((((...((.((((.((((((((......((.(((........))).)).((((((((..(((((....)))))))))))))..(((.(((((((..(((..(((.((((((....))))).)...)))..)))...))))))).)))).))))))).)))).))...)))))))..)))))......))))..((((((((((((((((((......)))))..))).)))))))))).......)))))))))))).((.(.(((....))).).))....((((((((.......))))))))((((((((((((((((.....((((..(((((..(...((((((((.((.((((((((.....((.(((...(((.......)))...))).))))))))))))))))))))(((((((((...((((.((((.........((((((...........)))))).........))))((..((((.((((.((((((.(((((((((((((((((.((.(((....))).))..((((.(((((.((......)).)))))..))))....(((((((((((((((((((((..(((((.((..(((((.....(((((.....((((((.......))))))..)))))))))))).)))))((..((((((((.........(((((.(((.(....).))).)))))..))))))))..))))))..)))).))))))).)))))).(((.(((((((((.((.((((((((..((.(((((((...(((....))).....)))))))))...))...)))))))).))).(((((..........))))).......((((((((.((((....)))).....((((.(((.((.(....))).)))))))...............((((((((((((.(((....(((.(((.((((((((((....)))).)))))).))).)))))).))(((((...(((.(((((((((...(((.(.(((((.....((((((((.(((........(((((.(((((((....))))...))).))))).(((((..........)))))....(((((((.(((.......))))))))))...(((((((....)))))))..((((((......((((...)))))))))).........)))))))))))....))))).).))).)).)))))).)..)))...(((......)))...(((((.(((((((((((((.((((((....................((((.(((((..(((((((((((((((..((((...))))...((((..(((((((((((.....))))).)))..(.(((((........))))).)((((........)))).(((((.(((.(((...(((((((..((((((((...((((.((((.....((((((((((((((((((....(((((((.((..(((.((.........))))).)))))))))...)))))))))).)))))))).....))))..).)))....))))))).)..))))))).)))))).)))))...((((((.......))))))..)))..))))......))))))))..).))))))))))).)))).)))))).)))).)))))).))).)))))....))))))))))))))).)))))))).)))))).)))..((((.(....).))))...(((..((((...........))))..))))))))))))))......(((.......))).......)))))).))))))))))))))..))........((((((((((.((((((((.(((...(((.(((.((..((((((...((((((((((.(((((...(((((.......))))).......(((.(((................))))))...)))))........................(((((.(((((......(((((((((((....))))))))))).......(((((.(((................))).))))).(((((((.......))))))))))))..))))).....................((((((..((((...............((((((.......)))))).....(((((((((.............)))))))))...(((..(((.....)))..)))..((((((.....)))))).....)))).))))))..)))))))))).))))))....((((((((((((((.((.((((......)))).)).)))....((((((.((((((...((((((((.((.(((((...(((((((.(((..((((.((((((((..((((.((((..(((((((((((((.(((.((((((.........))))))(((((.((((((((.......)))))))).))))).((((((((.(((....)))......((((.(((((...((......(((..(((.(.((((((((....(((((((...))))))).))).)))))))))..)))....))...)))))))))..((.(((..((...))..))))).((((((..((......))..))))))........((...............)).((((((........))))))..))))))))((((((.((((((((..(((..(((......(((...((((.(((((((.(((((((((((((((((...)).)))).(((........)))(((((((((....((((...(((((.(((..((((.((..((((((((....)))))).....))..)).)))).(((((...(((((.(((((((((((...((((((.((......((((((.(((....))).))))))((((((((((.........(((((((((((....((...(((((((.(((((.....(((((.....((..((((.((((.((((.((.(((((..(((((((((((((((((((....))))))).....))).))))))))).........((((((((((((......((....)).(((.((((.(((((....))))).)))).)))..((((....))))(((((((((((((..((((((.(((((((.....(((((.((((((..(((((....)))))..).))))))))))...))))))).))))))..))(.((((.((((.((((((((((((((((((((...........))))))))))..(((((........)))))(((....)))..........(((((((((..((...(((.(((.(((........))).))).)))...))..)))))))))...((((((((.....)))))))))))))).)))))))).((((....)))).)))).))))))))).)))...(((((.((((((((.....)))))).......))))))).))))))))))))..)))))))))))..))))))))..)))))))..)))))..)))))))..))..)))))(((((((....))))))).........))))))..))))))))))............((((((((((.(((((........))))).))))))))))(((((((.....)))))))...((..((((((((.((((....)))).))))))))..))....((((....)))))).)))))))))))))))))))))))))))..))).)))))...))))...))))))))).))))))))))).))).)))).))))....)))...))).))).....))))))))...))))))((((....))))....(((((((..((((((((((((((((((......(((((((((...))))))))).(((((((((((.(((((((...........)))).))).....(((((((((((((.((((.........(((.(((((.......))))).))).(((((.((((((.((.......)).)))))).))))).)))).))))).)))))))).....))))))))))).)))))))(((((((..(((....)))..))))))).....))).)))))))))).)))))..))).))))..))))))))).))))...))))..)))))))).))))..))).)))).))).((((..(((....)))..))))........((((((..(((((.((.............)).)))))....(((((.........)))))))))))(((((....)))))....)))))...)).)))))))))))))))))))).......)))))).))))).)).)))))).))).))))))))))))..))))))..)))).((.((((..(((((((((...)))))))))..)))).)).......................)))))))))...((((..((((....((((((.(((....(((((((((.((...((..(((((((....((((((((((((...((((((((((.........))))))))..))......))))))))).)))........)))))))...))........)))))).)))))...))).)))))).))))..))))(((((....)))))(((((......)))))...(((((((((...............))))))))))..))))).))))..)))))))))...))))))).))))))))..)))).))))))))).))))))))..........((((((((((..(((((...(((((((((((((((((...))))))))).))))))))..)))))..))))))))))....))))))))))......((((.((......)).))))........)))).))))).(((..((......))..)))..))))....))))).((((((....(((((((((..........((((...)))).........)))))))))...))))))..((((((((((..........((((((((((((((((.(((((..(((((((((.((....)))))))))))....(((....)))....((((((((((((((((((.((((.(((.............(((((((.(((......)))))).))))))).)))).)))..)))))))))....)))))).))))).))))).)))))...........))))))..)))))).))))............))).....))...))))))))....(((((((((((((((((((((((((((..(((.(((....))).)))....(((((........))))).....(((.....)))........(((.......)))(((((......))))).(((((((...)))))))..)))))).((..(((((....)))))..))..))))))))))).(((((((..((((((((...........)))))).))....)))))))............(((((((((((.....)))))....((((((((((.((((((..((.......))..)))))).((((((((.(((..((((((((.(((((.(((((..((........(((((.(((......)))(((((((((...)))))))))(((((((((((((.((((....))))......((((..((((....))))....))))(((((((((.(((..(((.(((((((((....((((((.(((((((((((.........)))))...............((((((...)))))).(((((((((((((.(((((..((.(((........))).)).(((((((.(((((((...((((((..((((((((((((((........))).((((((((.....(((.((((((((((((((((....(((((.((((((...................)))))).)))))........))))))).)).......(((((.......))))).........))))))).)))........((((((...))))))......((((((((((.(((((.((.((((.((((((((((((((((((((..(........)..)))(((......)))(((((....))))).....((((.((((.((((((((((((((((...((((((((((..........((((((.((((((((.((((..(((((....))))).))))...(((((((((((((((....((((.........(((((.(((((((....(((((..((...(((.((((((....).))))))))...))..)))))....)))))))))))).))))...)))))))))))).)))..((..(((((...)))))..))(((((((.(((((.((((((.....(((((..(((((.((.(((((((...((((..(((((((((.......)))))))))))))...(((((....)))))(((((((((.......((.((.....)).))(((((((((.(((((((.((...)).))))))).))).))))))...))))))))).....(((((........)))))(((((((((((....)))))))))...)).......(((....)))..((....))..........)))))))..)).)))))))))).....))))))..)))))..........((.((((((((....((((((...(((((((.......)))))))....(((((..........))))).(((((((((.(.....).)))))))))(((((..(((((..(((((.(.(((((((((..(.((((((.(((((((((........((((.((.((..(((((((((((..((.(((((((((....(((..........(((...(((..((((((((.(((((((.(.....).))))))).)).)))))).)))...)))..........)))..))))))))).))..((((((((((((......).))))..))))))).......)))))))..((((......)))))))))))).))))..........))))))))).)))))).)))))))))).).)))))..)))))....)))))))))))..)))))))).)).......))))))))))))))))))))).(((.(((...(((((..........)))))...))))))))))))))...))...))))...)))))))))))).))))))))))))))))).(((.(((((.((.(..............((((.((.(((((((((((((((.(((.(((.((((((....))))))...)))..))).))))...))))))))))).)).))))).)).))))).)))...)))))))))))).)).)))))..)).))))))))(((((...))))).......))))))))..))))))))..)))..)))))).....((((((.............)))))).....(((((((((((((..((((((...(((((((.((.((((((((((((........)))))))..((((((.((((.(((((.......(((........)))..))))).)))).)))))).((((.(((((..............((((((((..((((((((((.....))))))))))((((...))))..(((((.((((.(((.(((((((((..((((.((((.......((((.(((((((.((...((((......)))))).)))))))...))))......((((((((((.........(((((.....)))))........))).)))))))((((((((...(((((.((((.(((........))).)))).))).))....))))))))......((((((((((((.......................((((((........))))))...(((((....(((....(((.((((((((((((((((((...((((.........))))..)))))))...((((((((...)))).)))).((((((((((((((.(((((((.(((((((((((..(((......(((((.(((((((((((...........)))))).((((((((...)))...........))))).......((((((((((((((((((((((((((.((((((((((((..(((((.((((.(((((....((((.....((((((.(((.((((((........)))))).))).))))))...((((((((((((....))))))))))))((((((((((((((((((((((((((((((............((((((((....)))))))).(((((((.....(((..(((((....)))))..))).(((((((......)))).))).(((.((((((...((((.....))))...........(((((......)))))..)))))).)))(((((...((.(((........)))))..)))))...))))))).((((((((((((((((...((((((.(((.((.....(((((......)))))......)).))).))..(((((((((.................)))))))))..((((((((((((((((.((((((((((..(((((((((((.(((((((((...((((((((.....(((((((((((((((........((((((((.....))).)))).).........)))))..))))))(((((.((((((.(((((...)))))))))))))))).....((((((((..(........)..))))))))..............(((((((.(((((((((((.((.((((.(((...(((((.((((((........(((.((((.(((.....(((..((...))..))).....))).)))))))......))))))..)))))(((((...)))))...................))).)))))).)))))))).)))...((..(((.......))).))...)))))))..((.(((((.....))))).))((((((......))))))..((((......))))((((((((...)))))))).)))).))))))))))))).)))).)))))).......((((((((...))).)))))....(((((((.(((((..............((..(((..((((((((.....(((((..........((((((((.((((.(((((.(((((........((((((((........))))))))......))).)).))))))))))))))))))))))))))))))..).))..))...)))))....)))))))(((((((......((((.((.......))))))..)).)))))...((((((......))))))(((...))).)))))...)))))))))))))))))))))..)))))((((((......))))))((((((......((((((...))))))))))))....((((..(((...)))..))))...((((.....))))..))))..))))))))(((((((((.(((.((.......)).))))))))))))((((((.(((.((..((((((........))))))..)).))).))))))..........(((((((........(((.((((((((((((((......)))))).)).)))))).))).....(((((((((((....(((..(((((((..(((.(((((((((((..(((((((.((((((.(((............)))...)))))))))))))(((....)))....(((((((.......(((((....)))))......(((((.(((((..((((((((((((((.((.((((((.............))))))((((..(((.(((((((((....(.((................)).)...)))))))))..))).))))...((((((..((......))..)))))).((((((...(((((....)))))......))))))...)))))))))))....))))).))))).)))))....((((((....)))))).)))))))..(((((((..((((..(((.....)))..)))).)))))))....)))))).))))).))).)))))))....)))....)))).))))))))))))))....))))))))..(((((.......)))))........))).))))))))))))))))))))))))))).((((...(((((.......((((((........))))))....)))))..))))...........(((((((((((.((......)).))))))).))))...(((((((....)))))))..((((.(((.....(((((((....(..(((((....((((((((.((((..((((..(((((((((.(((((..((((((.((((((((((..(((((....((((((((........))))))))))))).)))))))))).))))))......)))))))))((((......))))............((((.((((........)))).)))))))))..))))..)))).)))).)))).....)))))..).....)))).)))....)))..))))(((((.......)))))((((((((....((((.((((.....((((((((..((((((((((((.....)))).(((((((((((((...(((((.((((..(((((((.((..(((((.((((((...((.(((((.((......)).)))))))))))))))))).)).......(((((((((........))).))))))........)))))))..)))).))))).((.((((...................)))).)).....))))))))))........)))..................((((.((((.........(((((....)))))...........))))))))...((((((((((.((.....)).)))...))).))))(((((((((.(((...((.........))...)))...)).)))))))((((.....))))...(((((.(((((((((((((((..........(((.((((....((((..((((((......)))))).)).))....)))))))............(((((....))))).(((.((((.((.((((....)).)))).)))).)))....)))).(((((((.(((((.((...............)).)))))...)))))))..((((((...........))))))))))))))))))))))............))))))))..))))))))..))))..)))))))))))).........((((.((((((.............))))))..))))))))....))))).))))...)))))..))))).)).))))))))))......(((((((((((((((((..((((((...(((..((..((((........(((((((.(......).)))))))(((..((((((........))))))..)))....(((((((((..(((....)))..)))))))))))))..))..)))...))))))...))))).))))))..((((((............))))))....))))))))))).)))))))))))).))))..................(((((....))))).................))))))))))..............((((.((((...(((.(((...((((((((((.....((((((....(((((((((((......)))))))))))((((((((((.(((.......)))))))))))))(((((((...(((((((((((....)))))))))))..)))))))((((((((((((....)))))))))))).............(((((((((.....)))))))))..((((...((((......(((.....(((((...........)))))....)))......))))))))))))))...))))))))))..))).)))..)))))))).....)))..)))))))))))..)))))))))....))).)))))))))))))))))))).)))..)))....)))))..))).)))))))))))))..))))..)).))))))).)))))))...)))))..((((.....))))....))))))))((((.((((((((((((((.(((((.....((.(((((...((......))..))))).))....)))))....))))))......)))))))))))))))))))))......((((((((((((((.(((((.((((..((.((((((((((.(((......((((.................))))......))).))))))))))...))..)))))))))...))))..))))))))))((((((((((.((((..................)))).))))))))))....))))).)))))))))...)))))).(((((((((.............)))))))))(((((((...)))))))..))))))))))))).))))))).)))))))....))))))))))))....))).)))..............)))))).))))))))))))))).)))....))).))))))))).)))).)))))))))....((((((.(((.((((((........)))))).))).).)))))....)))))...(((((((........((((.....(((((.(.(((((((.((((...(((((.((((((((.(((....(((......))).....)))...))))).(((((...)))))((((....(((((...........)))))....((((((((..((((((..((((((((..........)))))))).........(((((...............((((((....))))))(((((.((((.......)))).))))).((((((((..(((.....(((((((((((.(((((((.((((((....(((((.........((((((...((((((((((((((.................))))))))).................))))).....))))))..((((...((((.......(((.((((((....((((((....(((((((........((((((.((.((((...(((((((.....)))))))..)))).)).)))))).(((((((.....((((((((((.....))))))))))......(((((.((.((.((((.((((.............((((((((((.....))))))......))))(((((.((..(((((((..........)))))))..))..))))))))).))))))))))))).......))))))).(((((.(((....((((.((((...)))).))))...))).)))))..)))))))...))))))..)))))))))((((...((((...((((....((....))..))))....))))...))))...(((((((((((...((.((.....)))))))))))))))............))))....))))..))))).))))))..((((((((.((((..((((((((((.........)))))))))).....((((((((.....))))))))))))))))....)))).((((((((..((((....((..................))...)))).....))))))))....))))))).)))))))))))..)))..))))))))(((((((((((...((((.(((....(......)...))).)))))))).)))))))((((((..(((((.....((((((((((((((.....((((....)))).....))))))))...((((((......))).)))((........))..((((((..(((...)))..)))))).....(((((((((....)))))))))))))))...((((....((((((...))))))....))))))))).))))))....((((((.....((.(((........))).)).....)))))))))))..........((((.......))))....((((((((....(((((((.((((((.............)))))))))))))....))))))))))))))..(((((((.....(((...(((((((((...((((((((.(.(((((((...(((((((..((((((((....((((....(((((((..((((((.((.....)).))))))..((((....))))..(((..((((.......((((((....(((((((((..(((.(((..(((((((.((((((((((((....((((.((((((..(((((...(((((...(((......((((.((((.....)))).))))......)))..)))))............)))))((((((.((.......)).))))))...(((((........))))))))).)).)))).......))))))))))))..)))))))..))))))........))))))))).(((((((((((......((((......(((.(.((..((((((((((.(((..(((....)))(((....)))..(((((((.((..........)).)))))))..........))).))))))).))).)).))))......))))...(((.((((((((..(((((...((.((((....((((((.........))))))....)))).))...))))).)))))))).)))(((((.((....)))))))(((((((((.......(((((.......))))).......(((...((((.((((.(((.((((((((((((.....))))...))).....))))))))...))))..))))...))).(((((((....)))))))......................((((...)))).)))))))))((((......))))..((((.....))))...(((((...))))).))))))))))).((((((((((.................))))).)))))))))))))))..)))(((((.....)))))(((((((................))))))).)))))))......))).)....))))))))..)))..........))))...)))))))..).))).(((((((((((.......))))...)))))))...(((((((......(((((.((((((((..((...(((((.(((((((((((.(((((((((((((..((.(.............).))..))))).))))).))).)))).)))))))........)))))...))...)))))...))).)))))..))))))).......(((((..((.((....))..))..)))))(((((((((((......))))))))))).....((((((..((.(((((((((((.((((....)))))))))).)).))).)).)))))).....)))))...)))))))))..)))...))))))).))))))))..)))).........)))))))).)))).))))))).).)))))...)))))))))))((((((((.............................))))))))..((((((....))))))....))..))))).)))))))))))))..)))..(((((((..((((((((.(((.((((.(((..........((((((....(.((((..(((((.................))))))))).)....))))))........))).)))))))))).)))))........))))))).......((((((.((((...((((((.................(((((((((((((.....)))..)))))))))))))))).)))))))))).((((((...))))))(((.((........)).))).......)).)))))).............(((((((((((((((((.((((((((.(((((.(((....((((((((((.(((((((((((((.((((......)))).))))))))....)))))))(((((((((................))))))........))).(((.(((((..(((.(((((........))))).)))))))))))))))))))....)))))))).(((.(((((((((((((((((((((((...((.((((((((((((((((.....((((((((((.......))))))))))...(((((.((.((((...((((..((((((((((.(((((((...(((...(((((((..((..((.((((........)))).))..))..)))))))))).(((((.......)))))..(((((....)))))).)).)))).)).))))))))))))...)))).......(((((((......)).))))).....)))))))(((((....)))))(((((((((((((((((((((((.(......).))))))..(((((..((((......))))..)))))(((((......))))).....(((((((((((((((((........(((.(.....))))........(((.(((((.......((...(((((.....(((((.(((((((((((((((........((((((....))))))........)))))))))....((((((...))))))........(((.((((.((((((((.((....((((((.(((((..((((.((((((......((((((.(((...(((((.(((((.((((((............(((((..(((((((((((((....)))....................))))))))))(((((...)))))....((((((....(((((.((.(((((.(((((((.(((((..............))))).))))))).))..))).)))))))....)))))).)))))(((((((((((......))))))))).)))))).)).)))))))))).......))).)))))))).)))).))))..))))).))))))...........)).)).)))))).)))).))))))))).))))))))))...))....))))))))..(((..(((((((((((.(((((.((....)).))).))((((.(((((.(((.((((.(((.......................))).)))).))).))))).))))....(((.((.(((........))).)).)))..((.......((((((.((((((((((...((((.(((((((((........)))))...))))((..((((....(((((...)))))))))..))..((((((((((...))))))))))..(((((((......))))))).(((((((((((...........)))).))).))))((((.....))))...........)))).)))).)))))).)))))).......))...))))))))))))))...(((((((.(.(((((..(((((.....)))))..))))).).))))))))))))))))))))))))))))))))))))).))))........))))))).....((((((((.......((.(((.((..((((............(((....)))..))))..))...))).)))))))))).)))).))))).))...............((((((((((((.....((((((((..........))))))))))))))))))))..((((...)))).))))))))))).)))))).))).)))))).((((((.(((((.(((.....((....(((..(((((....(.((((.....((((((......))))))....)))).)...)))))..))))).....)))))))).))))))...))))..................(((((((...........)))))))........((((((((.......))))))))((((((....))))))....(((((((((((((((.(((((((((((((((((((........))))))))))))))))))).)))))))))))))))..))))))))).))))))))).)))(((((((.(((((((.((((..(.((((..(((((.((((.......))))...)))))..)))).)...)))).)))))))))))))).((((.....)))).))))))).))).....))))))(((((...))))).)))))))))).........))))))........

Transcripts

ID Sequence Length GC content
GCACUUGUACAUUUCUGCAGCCGCGCGGCGAGCCAUUCGCGGCGGCUGC… 19976 nt 0.4372
Showing 11 to 11 of 11 entries
Summary

This gene encodes a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation and may play a role in the development of proprioceptive neurons that sense body position. Mutations in this gene have been associated with medulloblastomas, secretory breast carcinomas and other cancers. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011] CIViC Summary for NTRK3 Gene

Forensic Context

A bioinformatic study in adult female Wistar rats (Rattus norvegicus) identified the NTRK3 as a gene enriched in the neurotrophin signaling pathway, which is collectively regulated by time-course differentially expressed microRNAs following spinal cord injury [Liu et al. DOI:10.1097/BRS.0000000000001323].