Basic Information

Symbol
NTS
RNA class
mRNA
Alias
Neurotensin Pro-Neurotensin/Neuromedin Neurotensin/Neuromedin N Neuromedin N NMN-125 NT/N NTS1 NN NT
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_006183.5
Sequence length
1239.0 nt
GC content
0.3454

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-282.20 kcal/mol
Thermodynamic ensemble
Free energy: -308.38 kcal/mol
Frequency: 0.0000
Diversity: 382.10
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((....((((((........))))))...(((((((((((((...((((....((((((...((((((((.................)))))))))))))).(((((((((.(((.......))).)).((((((((((((.((....(((((((..((((.(((((((....))))))).....))))..)))))))...)).))))................)))))))).......((((((.((..(((.((((.....)))).))).)).))))))....((((((((.(((((((((.(((((.(((((.((((..((..((((....((.........((((((((((((((.(((((....))))..((((((....(((....)))..)))))).).))).)))))....))))))))....)))))).)))).))))).)))))..(((((.((((.(((((................)))))..)))).........((((((....((.......))....)))))).((((((.(.((((...)))).).))))))..))))).............(((....)))((((((.(.......).)))))).......)))))))))...))))))))..))))))).(((((((((.((((...(((((((.(((((((((.((.((((((.(((.....................)))))).......))).))))))).)))).)))))))...((((.....)))).........(((((.....((((((...)))))).......)))))...)))))))))))))...........((((((((((....)))))))))).((.(((((((..((((..((((((...))))))..))))...))))))).))))))...((......)).....))))).(.((((.((((((.......(((((((((((........)))))))))))..))))))...)))).).(((((((.(((....))).))))))).)))))))).......(((........)))...((((((....(((((((((((.............(((((((((....))))))))).)))))))))))...))))))..)))))))..................(((..(((((.((((.............)))).)))))..)))
Thermodynamic Ensemble Prediction
..{(((({.,,,(({(({{((((({(((,,,{{{{(,((((((((,.{,({(,,,...}|||,,|},}|||||..}}}}}.|}}.},,)}}}}},||}}||||||},.{{(((((((,((,.......}}}.|}.((((((((((((.((....(((((((..((((.(((((((....))))))).....))))..)))))))...)).)))}...............}))))))))......,{(((((.((..(((.((((.....)))).))).)).)))))}.|{|{((({,,,.}}))}}}}..{((((.(((((.((((..{,.,((({,...,|||.....,.((((((((((((((.{{{{,..||))}}..{((({{,,..{{|,...))}.,))))),.}.})).)))))....)))))).,....,))))).)))).))))).))))}..(((((.((((.(((((.,{,,...,}},....)))))..)))).........((((((....((.......))....)))))).((((((.(.((((...)))).).))))))..))))).............(((....))),{{{({.{.,,...{|{||||||,{,.,,|}}}},||||.||||}|||||..,,}}}}..{{((((({{{((({.,,{{{{{{{,{{{{{{{{,.{{,{{{.,||||,..,,.|||,,,,.,|||,..,))})}}|,,,|,,}}},|}}}}}}.|}}|,|||}}},.,}||{,..,,|}},,.,,..,,..|||{|,,,,,((((((,..})}))),,,,...}}))}},,))))}}})))))),,,,.}||,..((((((((((....)))))))))).((.((((((({.((((..((((({...})))))..)))).}.})))))).)){{{...,}}..,,,,||...||...}),})},||,|||{{{..,....{((((((((((........)))))))))))..})}}}}.,{||||{{,(((((((,{{(....)))})))))))..,}}}}|.,|||.,,,,}}}.,.}}))}},..((((((.,..(((((((((({........,{{{,{(({((({,....)))))))))}))))))))))).,.))))))..}}}}}}}...,,,,,,,|.,,,,..,||..|((((.((((.............)))).))))}..,,.

Transcripts

ID Sequence Length GC content
AUAGUUCACUCACUUUCAAAGCCAGCUGAAGGAAAGAGGAAGUGCUAGA… 1239 nt 0.3454
Summary

This gene encodes a common precursor for two peptides, neuromedin N and neurotensin. Neurotensin is a secreted tridecapeptide, which is widely distributed throughout the central nervous system, and may function as a neurotransmitter or a neuromodulator. It may be involved in dopamine-associated pathophysiological events, in the maintenance of gut structure and function, and in the regulation of fat metabolism. Neurotensin also exhibits antimicrobial activity against bacteria and fungi. Tissue-specific processing may lead to the formation in some tissues of larger forms of neuromedin N and neurotensin. The large forms may represent more stable peptides that are also biologically active. [provided by RefSeq, Oct 2014]

Forensic Context

A study in mice demonstrated that chronic intermittent ethanol exposure and forced swim stress induce distinct transcriptomic adaptations in the nucleus of the solitary tract, with a unique gene expression pattern in the combined stress and dependence group suggesting synaptic and glial functional adaptations may drive stress-induced alcohol drinking [Grantham et al. DOI:10.1016/J.Neuropharm.2023.109768]. A study in rats demonstrated that a single administration of MDMA significantly increased the mRNA expression of the NTS in specific striatal subregions three hours post-injection, with increases observed in ventral quadrants of the rostral striatum and dorsomedial aspects of the middle striatum [Adams et al. DOI:10.1016/J.Molbrainres.2004.10.005].