Basic Information

Symbol
ARL2BP
RNA class
mRNA
Alias
ARF Like GTPase 2 Binding Protein BART1 BART ADP-Ribosylation Factor-Like Protein 2-Binding Protein ADP Ribosylation Factor Like GTPase 2 Binding Protein Retinitis Pigmentosa 66 (Autosomal Recessive) ARF-Like 2-Binding Protein Binder Of ARF2 Protein 1 ARL2-Binding Protein Binder Of Arl2 RP66 ADP-Ribosylation Factor-Like 2 Binding Protein ADP-Ribosylation Factor Like 2 Binding Protein Arf-Like 2 Binding Protein BART1 Binder Of Arl Two RP82
Location (GRCh38)
Forensic tag(s)
Forensic psychiatry evaluation

MANE select

Transcript ID
NM_012106.4
Sequence length
1969.0 nt
GC content
0.4373

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-573.00 kcal/mol
Thermodynamic ensemble
Free energy: -611.50 kcal/mol
Frequency: 0.0000
Diversity: 582.12
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((..(((((......)))))(((((((.(((((((((((..((((((..((((.....).).))..)))))).))))))))))).)))).)))((((((((((.(((((((((.(((((((((((((((........).))))))))).....))))).))........((((((.(((((((((....(.((((((((((...((((((........)))))).(((((((.......(((..(((((((..(((.(((....)))..(((.(((......))).)))............(((((((((((((((((.....))))).......(((((....((((((.....(((((....))))).....))))))))))).....................(((((((((.((((((((((((.(((......((((((...((((.(((((((((.........))))).)))).)))).....)))))).....)))(((.((((...((((((((((..((((..((.(((((.((((...)).)).)))))..))..))))))).((((((....)))).))...)))))))..))))..)))...(((((....)))))...)))))))))))))((((((.((((((((.((((........)))).))...)).)))).))))))...((((...........))))........(((((((.........)))))))..((....)).....))))))))(((.....))).))))))))))))))))))))))..))).....(((.(((((((.....((((((....)))))).((((.((((((((((((.(((((...(((((.......))))))))))......((((((....)))))).(((...((((((......))).)))...)))....)))))))).))))))))..((((.....((((....))))......))))....(((((((((....(((((((((((.((((((((((((((((((((((((((((..(((((((.(.((((...(((((...((((((((((.........(((((.(......)))))).........))))))).)))...((((((..(((.((.(((..((((((....))).)))..))).)).)))..))))))....))))))))).).))).)))).)))..((((..((((((...)))))))))).(((((((......)))))))......)))))))))).)))))..)))))(((((((..((((.((((...)))).))))))))))).((((..((.(((((...))))).))..)))).((((((..((((((...((((((((((....))))))).)))))))))..))..))))...)))))))).....)))).)))))))))).)))..(((((.(((((....(((....))).....))))).)))))...))))))))))....(((.....((((((....))))))))))))))))(((.(((.(((((...(((((.......))).))...)))))))))))..)))))))))))..)))))))))))))))(((((((.((((((((...)))))))).))))))).((((((((..(((((((((((((((....(((.....))).....)))))).)).))...)))))........))))))))...)))))..)).)))).))))))...(((((((.(((((.......))))).))))))).((((.((.....(((..(((.....((((((........))))))...)))..)))..)).))))(((.((...((((((....(((....)))..))))))...)).)))((((.(((....))).))))...)))).
Thermodynamic Ensemble Prediction
..{(((,,((({,..,,,.,)))}(((((((.(((((((((((..((((((..(({{.....,.).))..)))))).))))))))))).)))).)))((((((((((.(((((((((.(((((((((((((((........).))))))))).....))))).)).....,{.((((((.(((((((({....(.((((((((((.{{(({({{....,,,.}}}}}}.(((((({.{{{,,.(((..(((((({..(((.{{{,...,||,,(((.(((......))).))}............((((((((((((,((((.,.,,|}},,..,,}..{|||||,..((((((,....(((({....}))))....}))))))|||||,,...................,||{|||||.((((((((((((..,,.....,(((((,...,((,{((,((((({{{{{{{,..,,,,,{||||,||,,...,}))))),.....)))|||}||||}}}|||,,,,|||}}|(((..((.(((((.{{{,...,}.}}.)))))..))..)))}|||.,{((((....)))).))|..,||||,,.,)))|,,|}}.,,((,,,...,)))))}}})))))))))))),{(((((.(((({(({.((((........)))).}}...)).)))).))))))|}.{,{,,,,,,,....,}},,.,,.....(((((((.........)))))))..,,....)),....}}}})))}{{,.....,,,.))))))))))))}}})))}}}}..}}}.,,,,{,,,(((((((....,({((((,{{{||}|||,({((,((({((((({{((((.....{{((((.,{{{{{||{((((({,...,}}}}|(((,,{(||||||,|||,..({((((......}})},}},},,,,.,,,.}}})))),)))}}}))|.{(({.....((((....))))......,}||,..|(((,..(((......)))...}))}}})))||||,||||||||||{|||||||}}||,{((({({,,.|}}}|||||,..||||{||||||,||,.,{,,{,,|.,...{{{{{{|||{{,..|,,.|||||||,,,,...((((((..(((.((.(((..((((((....))).)))..))).)).)))..))))))...,)))))))}|.,.}}},}|||{|,,.,(((({{{(({{{.,,||,,||||}|.(((((((......))))))).,,,,,,)))})||||{|}}||...,}},(((((({,,((((.((((...)))).))))))))))).,,||.,|,.|||||,..||||}{||{{||||.{(((((,.{(((((|..{{{(((((((....))))))).}})}))))}..||..{{||......}))))}},,),))).)))))),)))})))}}}||||}||||..,,,{||}}}})))}}.,,,,)))}))}}}||,,}}})))}}},...,||}}}}}|,,,,,||,,.,,},,}}}))))))){(,{(((.(((((...{((((.......))),}}...)))))))))))..))))))))))).,))))))))))))))),}|{(((.((((((((...)))))))).)))),,,.((((((((,,(((((((({(((((({.,.({{.....))).....}))))),)).}}...}}})},),},....}))))))...)))))..)).)))).))))))...(((((((.{((((,......))))).))))))).{{{,.{{,...,|,,..{(({{...}))}}...|||,{{|||||,..)))).}}),}}},.}}}|(((.((...((((((....(((....)))..))))))...)).)))((((.(((....))).))))...}})}.

Transcripts

ID Sequence Length GC content
AGUGAGCUGGCCGCGGCCUUGGCUGAGAGGCCUUAACCCCGCCGGGCGG… 1969 nt 0.4373
Summary

ADP-ribosylation factor (ARF)-like proteins (ARLs) comprise a functionally distinct group of the ARF family of RAS-related GTPases. The protein encoded by this gene binds to ARL2.GTP with high affinity but does not interact with ARL2.GDP, activated ARF, or RHO proteins. The lack of detectable membrane association of this protein or ARL2 upon activation of ARL2 is suggestive of actions distinct from those of the ARFs. This protein is considered to be the first ARL2-specific effector identified, due to its interaction with ARL2.GTP but lack of ARL2 GTPase-activating protein activity. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human postmortem brain tissue demonstrated that the ARL2BP is up-regulated in the motor cortex of alcoholic cases compared to controls, as part of a broader pattern of differential gene expression in myelin-related functional groups that accurately distinguished alcoholic from control individuals via hierarchical clustering [Liu et al. DOI:10.1111/J.1471-4159.2004.02570.X].