| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUGAGCUGGCCGCGGCCUUGGCUGAGAGGCCUUAACCCCGCCGGGCGG… | 1969 nt | 0.4373 |
ADP-ribosylation factor (ARF)-like proteins (ARLs) comprise a functionally distinct group of the ARF family of RAS-related GTPases. The protein encoded by this gene binds to ARL2.GTP with high affinity but does not interact with ARL2.GDP, activated ARF, or RHO proteins. The lack of detectable membrane association of this protein or ARL2 upon activation of ARL2 is suggestive of actions distinct from those of the ARFs. This protein is considered to be the first ARL2-specific effector identified, due to its interaction with ARL2.GTP but lack of ARL2 GTPase-activating protein activity. [provided by RefSeq, Jul 2008]
A study in human postmortem brain tissue demonstrated that the ARL2BP is up-regulated in the motor cortex of alcoholic cases compared to controls, as part of a broader pattern of differential gene expression in myelin-related functional groups that accurately distinguished alcoholic from control individuals via hierarchical clustering [Liu et al. DOI:10.1111/J.1471-4159.2004.02570.X].