Basic Information

Symbol
NUDT21
RNA class
mRNA
Alias
Nudix Hydrolase 21 CFIM25 Cleavage Factor Im Complex 25 KDa Subunit CPSF5 Cleavage And Polyadenylation Specificity Factor 25 KDa Subunit Cleavage And Polyadenylation Specific Factor 5, 25 KD Subunit Nudix (Nucleoside Diphosphate Linked Moiety X)-Type Motif 21 Cleavage And Polyadenylation Specificity Factor Subunit 5 Cleavage And Polyadenylation Specific Factor 5, 25 KDa Nucleoside Diphosphate-Linked Moiety X Motif 21 Pre-MRNA Cleavage Factor Im 68 KDa Subunit CPSF 25 KDa Subunit Nudix Motif 21 Pre-MRNA Cleavage Factor Im 25 KDa Subunit Pre-MRNA Cleavage Factor Im, 25kD Subunit Pre-MRNA Cleavage Factor Im (25kD) CPSF25 CFIm25
Location (GRCh38)
Forensic tag(s)
Wound age identification

MANE select

Transcript ID
NM_007006.3
Sequence length
4393.0 nt
GC content
0.3701

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1125.10 kcal/mol
Thermodynamic ensemble
Free energy: -1215.84 kcal/mol
Frequency: 0.0000
Diversity: 938.90
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...(((((((((((........(((((((((((.((..((....((((..((........)).))))(((.(((.........))))))..))..))..))))))))))))))))).((.((((((((((..((((((((....((......))))))))))..))))))...(((((((...((.(((..((..............)).))))).))))))).....((((.(((.........)))...))))((((((........)))))).....)))).)).....(((((((((((....(((((((((((((((((((((.(((((((..(((((....)))))(((((((((.((((((((((.(((((.(((..(((......))).)))..)))))..........((((.(((((((((((((((((((((..((.(((((.(..........))))))))....)))))...(((..........))).....(((.....)))((((((((((((..(((((....)))))..))).)))))))))....(((..(((((.((((..............)))))))))..)))(((.(((((((............))...))))).))).))))))))))))))))))))..((((.......)))))))))))))).....((((.(((((((((......))))..)))))))))((((....)))).(((.....)))..)).))))))).....))))))))).)))))(((((((((..............))))..)))))((((.(((.((((..........)))).)))))))........((((((...)))))).(((((((((((((((((((((((........(((.(....).)))..((((((.((.((((((((.......((((((((.(((((((((((((((((.((.(((((.(((((((..........)))))))))))).))))))))..))))........((((((((((.((((((..(((.((((.(((.((((((..(((.(((((..(((((((((((((.(((((.(((.......)))...)))))))))).(((((((((((((.(((((....((((((((..(((((.......(((((....(((((.((......))..))))).....))))))))))..))))))))))))).))....((((((((((.....(((((((.......(((((((((((((...((((...(((((...(((((((((((..((....)).)))))))))))((((((.(((..((((((......(((.(.....((((((.......)))))).........).)))......))))))..))).).))))).....)))))....)))).....).))))))))))))......)))))))......))))))))))......((..((((((((((((((((((((((((((..((.......(((((((((((((((((...((((((((..(((((.....(((....((((((((((...(((((.(..(((((((...(((((.....))))).)))))))).)))))...))))))))))...((((.((((((((...(((((((....)))))))......................(((((((((((.(((((((((.(((((((.......)))))))......(((((((...)))))))....((((.....)))).(((((.((((((.(...................((((...(((((((((.(((((((((((((.((((.((((..(((....)))..)))).........(((((.....(((((((((....(((((....(((...(((.((((((.........((((((((...........)))))))).........)))...))).))).)))....)))))..)))))))))...)))))((.(((((....(((((.....)))))....))))).))...(((((((.((((......))))..)))))))((((........)))).....)))).))))))))))))))))))).)))..))))((((((.(((((.....)).))))))))).......).)))))).....)))))......(((.......)))..)))))))))..)))..))))))))..((((.((((.((((....(((((((.(((.......))))))))))....(((((....(..(((((((..((((.(((((((((((......))).)))))))).)))).......))))))).)..)))))(((((((((((((((((....(((.(((...((..((((....))))..))...))).)))..)))).))))))))))))))))).)))))))))))))))).)))).........(((((......)))))((((((((((..(((((....)))))(((....)))..........)))))))))).....)))))))))))))))).))))....(((((((.((((((((......((((((..((((.((((((((((.......((((...............)))).......)))))))))).))))....((((.....)))).....((((((((((((((((((..((.(((.(((...((((((((((((((...(((((.(((........))))))))((((((((..((((((....((((((....))))))))))))))).)))))......((((((...((((((.(((..((((((((((...(((.((((.......))))..)))...))))))))))...))).))).)))...)))))).........(((((.......)))))....(((((.(((........))))))))..))))))).))))))).)))))).(((((.....)))))...)).))))))))))).))))))).........((((((((((((((((((.........(((((........))))).....(((((((((.............))))))))).)))))))))).(((((((((.(..........).))))))))).....))))))))))))))....)))).)))))))))))..)))))))..)))))).))..)))).))).))))))))......(((((.....)))))........(((..(((((.......)))))..))).).))))))))))..)).(((((..((((....))))..))))).....)))))))))))....))))))))..))))))))....)))))).)))......((((((.((.....)).)))))).((((.(..(((((.((.((.((((.((((.((((((...........)))))).)))).))))))..)).)))))..))))).)))).))).)))))).))))))))))...(((.((((((((((........((((((((((((.(((((.((((...((((((((((((((.(((......))).))).))))...((((.....))))........))).))))....)))))))))....((((((((((((..(((((((((((...))))))).)))).))...(((......))))))))))))).(((((........)))))(((......)))....(((.((((....((((...((((.........((((((..((((....((((.((((.(((((((((..(((((((((.........((((........)))).........)))))...))))..))))((((((((.(((.(((((((...(((........))))))))))..)))))))))))........(((((........))))).))))).)))).)))).))))))))))..........)))))))))))).)))))))))))))))..)))))))))).))).))))))).)))))))).......))))))))...))))))))(((.((((((((((((.(((((((.......))))))).)))))..........))))))).)))))))))))))))...))))))))))).(((((((((.((((..(((........)))...)))))))))))))......)))))))))...)))))..)))))))))))...((((((((......)))))))).........)))))..
Thermodynamic Ensemble Prediction
...(((((((((((........(((((((((((.{{..((.{{{((({..((,,......||,||||,{,.{|||,.......)))))}..))..}}..))))))))))))))))).((.((((((((((..((((((((....({......))))))))))..))))))...(((((((...({.(((.,({...........,,,)).))}}}.))))))).....{({{.{,,.........})}.,,)}}}((((((........)))))).....)))).)}..,..(((((((((((.,,.{(({{((((((((((((((((.(((((({,((,,,,....,,}||(((((((((.((((((((((.(((((({({..,{({{{{((((....)}}...,)}}))}.....((((.(((((((((((((((((((({..{(.(((((.{,|.......,)))))),,....|},||{{,,,{,.,.......,}}.....{{{.....))){(((((((((((..(((({....}))))..))).))))))))}....(((..(((((.((((..{{.....}}...)))))))))..))){{{.((((({{............}}...))))).}}).))))))))))))))))))))..}|||,...,})))).))))))))))......{{{.(((((((((......))))..)))))}}}|((((....))))}(((.....)))..)).)))))))...))))))))))).)))))((((({(((.,{........,,.))))..)))))((((.(((.((((..........)))).)))))))..,,,,..{{{{{{...))))}}.(((((((((((((((((((((((..{{....{{{.{....}.))},,((((({,((.((((((((.{{,...((((((((.(((((((((({((((((.((.(((({.(((((((..........)))))))})))).))))))))..}}},........((((((((((.((((((..(((.{{{{..,,.,(((((..(((.(((((..((((((({(((((.(((((.(({.......}}}.,.)))))))))).(((((((((((,{.,(((((((,,{((({{{|||,,{({{,....,}|}}}...,,.((((((({,(.(((((((.......})))))).}))))))))...,}|||,|},,..((((((((((.....(((((((.......(((((((((((({...(((({{.(((({..,(((((((((((.,(,....)}.)))))))))))|((((,,(({.,{(((((......(((.{.....((((((.......)))))).........,.))}......})))},,|})}.}.))))}.....))))).})})))).....}.))))))))))))......)))))))......)))))))))).....,||..((((((((((,(((((((((((((((..((.....,,(((((({((((({((((...(((((((,.,(((((....,(((....,{{(((((((...(((((.(..(((((((...(((((.....))))).)))))))).)))))...)))))}}|||,,,.,||,|||,||||}}}{{(({{,....||}}||}.....,,....,..}}}},,,.(((((((((((.(((((((({{(((((((.......))))))),)....{(((((,...})))))}....((((.....))))...,,,.{(((((.{..................,((((...((({(((((.(((((((((((((.((((..{{,..((,.{,{||{{{{.{|{{{..{,{|{{{{{.,,,,|{{{{{|||,..,|||{{....{{{.,,{{{,{(((((.....,...((({((((,,......,,.}}})))))..|,,,,,.}})}|,|||}||,.|}}....}))))..}})))))}}.,,))))}||}|||||.|}|{||{{,,...}}}}}}}..}})},}))}.,|{{{{{{.{(({......))))..}))|}}|((((........)))),.,,.)))).))))))))))))))))))}.)))..)))){(((((.{({((.....)).)}})))))).......}.))))))}}|,.,}})},.....(((.......)))..,))))))))..)))..))))))))..{((,{((((.((((....(((((({{(((.......))))))))))....(((((..,..{((((((((..((((.(((((((((((......))).)))))))).))))..,....)))))}},},.))))){((((((((((((((((....(((.(((...((..((((....))))..))...))).)))..))))))}))))))))))))))).)))))))}||}}||||,}},,.,},,....(((((......)))))(((((((((({((((,({{..,,,,,(((....)))}}}}}}}}}.}))))))))).....}}}))))))))))))).))))....(((((({{((((((((......{(((({..((((.((((((((((.......((((...............)))).,.....)))))))))).))))....{{{{..,{{||||{{,,.((((((((((((((((((..((.{{{.{({...((((((((((((({...{{{((.(((........)))))}|}(((((.,{,,((((((,,,.((({{{.,,,}))))})))))),)).)))))......((((((...(({(((.(((..((((((((((...(((.,,((....,,.})},..)))...))))))))))...))).))).}))...))))))...,.....,,{{|.......|},,..},.(((((.(((........))))))))..})))))).))))))).})))))..,{{{.,,..,,,,},..)).))))))))))).)))))))........}||{||||{{(((((((((.,......,{{{{{,,{{....|,,}}|,...(((((({{{,,..........}))))))))).)))))))))).(((((((((.(.{,....}}.).))))))))).,,,,))))}}},}}}))),...)))).)))))))))))..)))))))..))))))}))..))))}})).)))))))}......(((((.....))))).....,||(((..(((((.......)))))..))).)}}))))))))),|||.,{|||,,{{||,,,,,))),,))})}.,,,.)))))))))))....})))))))..))))))))....)})))|,|||,{{{,.{{{{{{,{,.,,}})}.)}}}}}.{(({.(,.(((({.((.{{.{{{{.{{{{.||||{{.,,,,,.....)))))).}}}}.)))))),.}).}}}}}..,)))),}))}.))).)))))).))))))))))...(((.((((((((((........((((((((((((.(((({,((((,,.((((((((((((((.(((......))).)))}}))},))}|{{.....}},..,,,.,,,,,..))))..,,)))))))))....((((((((((({..(((((((((({...})))))).)))).}}...(((......))))))))))))).(((((........)))))(((......)))....(((.((((....(((({{(,{,,..,,.....((((({,.((((....{(((.((((.(((((((((..(((((((((.,,.,{{{.{(((......,,}}))}},....,.)))))...))))..))))((((((((.(((.{{{{{{,..{(((........))))))))))..)))))))))))........((({{......,,)))},.))))).)))).)))).))))))))))...},.....))))}))))))).)))))))))))))))..)))))))))).)))}))))))).))))))))...,}}.))))))))...)))))))){((.((((((((((((.(((((((.......))))))).)))))..........))))))).))}))))))))))))..,))))))))))).(((((((((.{((,..(((........)))...))),)))))))))......)))))))))..,}})),..))))))))))).,.((((((((......)))))))).........)))))..

Transcripts

ID Sequence Length GC content
CUCCUCUUGCGCUGUCCUGUUAAUGGCGGGCAGUAGCCGCUGAGGGGAU… 4393 nt 0.3701
Summary

The protein encoded by this gene is one subunit of a cleavage factor required for 3' RNA cleavage and polyadenylation processing. The interaction of the protein with the RNA is one of the earliest steps in the assembly of the 3' end processing complex and facilitates the recruitment of other processing factors. This gene encodes the 25kD subunit of the protein complex, which is composed of four polypeptides. [provided by RefSeq, Jul 2008]

Forensic Context

A study in porcine skin demonstrated that the NUDT21 was significantly decreased in response to thermal exposure at 7 days post-injury [Price et al. DOI:10.080/15569520903097754].