| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUUCGGUCCUGAGCGCUUGGGAGUUAGGUUGUUUGCCGGCGUAGCGGC… | 4091 nt | 0.5368 | |
| ACUUCGGUCCUGAGCGCUUGGGAGUUAGGUUGUUUGCCGGCGUAGCGGC… | 2290 nt | 0.5114 |
This gene is one member of a family of nuclear RNA export factor genes. Common domain features of this family are a noncanonical RNP-type RNA-binding domain (RBD), 4 leucine-rich repeats (LRRs), a nuclear transport factor 2 (NTF2)-like domain that allows heterodimerization with NTF2-related export protein-1 (NXT1), and a ubiquitin-associated domain that mediates interactions with nucleoporins. The LRRs and NTF2-like domains are required for export activity. Alternative splicing seems to be a common mechanism in this gene family. The encoded protein of this gene shuttles between the nucleus and the cytoplasm and binds in vivo to poly(A)+ RNA. It is the vertebrate homologue of the yeast protein Mex67p. The encoded protein overcomes the mRNA export block caused by the presence of saturating amounts of CTE (constitutive transport element) RNA of type D retroviruses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the NXF1 mRNA was down-regulated (0.26-fold) in bone marrow cells 6 hours after 6.5 Gy whole-body ionizing radiation [Dai et al. DOI:10.1080/09553000600857389]. In human peripheral blood leukocytes, the NXF1 was identified as a housekeeping gene in the signaling and communication class and exhibited differential expression between monozygotic twins, belonging to the least variable category of natural variation [Sharma et al. DOI:10.1152/physiolgenomics.00228.2003].