Basic Information

Symbol
ARL6IP5
RNA class
mRNA
Alias
ARF Like GTPase 6 Interacting Protein 5 GTRAP3-18 DERP11 PRAF3 JWA HSPC127 Yip6b ADP-Ribosylation Factor-Like Protein 6-Interacting Protein 5 ADP Ribosylation Factor Like GTPase 6 Interacting Protein 5 ADP-Ribosylation Factor-Like 6 Interacting Protein 5 Cytoskeleton-Related Vitamin A-Responsive Protein Glutamate Transporter EAAC1-Interacting Protein Prenylated Rab Acceptor Protein 2 ARL-6-Interacting Protein 5 PRA1 Family Protein 3 PRA1 Domain Family 3 Protein JWa Addicsin Aip-5 JM5 ADP-Ribosylation Factor GTPase 6 Interacting Protein 5 ADP-Ribosylation-Like Factor 6 Interacting Protein 5 Glutamate Transporter EEAC1-Associated Protein Putative MAPK Activating Protein PM27 Putative MAPK-Activating Protein PM27 Dermal Papilla Derived Protein 11 Dermal Papilla-Derived Protein 11 Hp22 PRA2 Jmx
Location (GRCh38)
Forensic tag(s)
Chronological age estimation

MANE select

Transcript ID
NM_006407.4
Sequence length
2134.0 nt
GC content
0.3927

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-553.94 kcal/mol
Thermodynamic ensemble
Free energy: -598.43 kcal/mol
Frequency: 0.0000
Diversity: 526.30
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((...(.((((((((((((.....)))))...........(((((...)))))))))))).)...))...((((.((((...)))).))))((((((((((.((..(((((((((..........(((........)))(((((((........)))))))((((..(((((((((......(((((.(((((((..((((....)))).......((((((((((...))))).)))))(((.(((.((((...))))))))))((((((((.....)))))))).))))))))))))(.((((((((((((((.((.((((((((((((((((((((((((((.......)))))))).))...........(((((......)))))....)))))))))..))))..))).)).))).))))))))))).)..............(((((....))))).(((((((((((((((((((........(((((((..(((((((((((........))))).........((((..((((.....((((((......................))))))..))))...)))).(((((((......)))))))...)))))))))))))))))).))).)))).)).)))))......))))))))).))))..............(((.((.(((((((((((.........))))))....))))).)).)))..))))))))))))))))))))).....((((.((((..((((((((((.((.(((.((((((((.((((..((((......))))......((((((....))))))........(((((...(((((((..........((((((..((((((((((((....(((((((((((....((....))...))))).)))))))))))....((((((((((.((((.((((((........))))))(((.((.((((((...((((((.(((((((......(((((.....((((.......)))).....)))))..((((((.((..((.(((...))))).)).))))))..((((((.(..(((...(((((.((((.((((.........(((((((.........)))))))(((((.((((....)))))))))((((.(((.......))))))).(((((((...))))))).........)))).))))..)))))...)))..).)))))).......(((((....))))).......(((((((.((...(((....)))..)).)))))))..................)))))))))))))(((((((....))))))))))))).)))))...(((((((...................................))))))).........(((((((((.........((((((..(((((((((.((......))...))))))))).))))))(((.(((((..(((((...))))).))))).)))..))))))))))))).))))))))))..)))))))))))))..............)))))))...))))).....((((((...((......)).))))))........(((((..(((.(((....(((((...)))))((((.((((....))))..)))).))).)))..))))).(((((((((((..((((((.((((..(((((((.(((........))).)))))))...........)))).))))))))))))..))))).......))))..)).)))))).....(((((((.((.((((...(((((((......))))))))))))).)))))))..))).)).))).))))))).......(((.....))))))).))))(((((.(((((((.........))))))).)))))...((((((.((((.(((((.((((.(((..((((((.(((........((((..(((...)))..))))))))))))).))).............(((.....((.((........)).))....)))....))))))))).))))...))))))
Thermodynamic Ensemble Prediction
((...(,((((((((((((.....)))))...........(((((...))))))))))))..||.,,.,.((((.((((...)))).))))(((((((({{{((..(((((((((..........{((........))}(((((((.,....,.)))))))|(((..(((((((((...,..(((({{(((((((..{(((....)))}.......((((((((({...})))).)))))(((.((,,((((...))))))))))((((((((.....)))))))).)))))))))))),.{(((((((((((((.((.((({((({(((({(,((((((((,,,...,{{{||||||,..)))}},.,,,,..(((((......)))))..,.))))))),}))))}),}))).)).))).))))))))))}.|,,...........,(((((....)))))},|..((((((..((.(((((......(((((((,.,(((((((((((........))))).........((((..((((.....((((((......................))))))..))))...)))).(((((((......)))))))...)))))))))))))))..,....))))).))..))))))..,.))))))))).)))}..............(((.((.((((({(({((,,.......}))))}},..))))).)).)))..))))))))))))))))))))).....((((.(((({.((((((((((.{({((({(((((((,{((,((((,(({{{{..||,,..,,,.((((((....)))))).{,{{{{.(((({.{{,,,.{{...........,,{{||.,|||,|||||.|}}},.(((((((((((....((....))...))))).)))))){{{{|{,,.,||||||{,,......,,{,||.....}}}))),))}}|}|..,,,,,,...,{{{,,.,|||,........(((((.....((((.......)))).....))))}..,,||||}}...||}}|||,.{{||,.||{||,}}|.|||{{..,((((({{{{{{{{{{,{{{{{(({|{{{{{...,,,}|||,,,}}}},.,......(((((.((((....)))))))))(((,{(((.......))))))).(((((((...))))))){{{{{{..{(((({{,,,..,,,...,|||{{{|{{{{{|{{{....,(((((....}))}}.....,{((((((,.,,...|||,}},)),{{||{|,,,,))}))),...{,,,,.|,..,||,},}})))}}(((((((....))))))).,,,,)})))))}}}}}.||||,,........,{{,,,{{{{{{{{....{,,....|||||,...,,,...,||,,,|||}}}}}}}}},((((((..(((((((((.{(,.....,,.,.))))))))).)))))),,{,((((,..,{|||,}..}}}}.},)))}))))}))))}})))},))}}}))))),,)))))),},,)))))},...}}}}},,)))).{{{{,....,|,},,...((((((...{{......}}.)))))),,,....,((({({..(({{.,.{{{(({{{{,,||}||((((.{{{{....|}}}..}}||,..,,,,,..,,}}}.{({{({(((({..((((((.((((..(((((((.(((........))).)))))))...........}))).)))))}})))))..|||||,......,}}}.,))}}))},,..,|||,..,}},,}}||||.,}|||{{{|}}},..}))))},))})}},...|{{{...,)})}.))).))))))).....,,{{{...,})}))))).)))){((({.(((((((.........))))))).})))}...{(((({.((((.(((({,((((.{{,.,((((((.(((.....,..((({..{{{,..})},,}}}}))))))))).,,,...,,},....,,........,,..,.........,},,,,.,))},...})))))))).))))...))))),

Transcripts

ID Sequence Length GC content
GCAAAGCCGACCGAGACGGAGCCGCUGUCAACUCUCCAACUCAGCUCAG… 2134 nt 0.3927
Summary

Expression of this gene is affected by vitamin A. The encoded protein of this gene may be associated with the cytoskeleton. A similar protein in rats may play a role in the regulation of cell differentiation. The rat protein binds and inhibits the cell membrane glutamate transporter EAAC1. The expression of the rat gene is upregulated by retinoic acid, which results in a specific reduction in EAAC1-mediated glutamate transport. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans identified the ARL6IP5 as an mRNA marker for age estimation, finding it to be increasingly expressed with age in a U.S. whole blood RNA-Seq data set [Dørum et al. DOI:10.1016/j.fsigen.2023.102976].