Basic Information

Symbol
ODF1
RNA class
mRNA
Alias
Outer Dense Fiber Of Sperm Tails 1 HSPB10 ODFPG ODF27 CT133 RT7 Heat Shock Protein Family B Member 10 Outer Dense Fiber Protein 1 Heat Shock Protein Beta-10 Cancer/Testis Antigen 133 ODFP Outer Dense Fiber Of Sperm Tails, 27-KD Outer Dense Fibre Of Sperm Tails 1 ODFPGA ODFPGB HspB10 ODF2 SODF ODF
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_024410.4
Sequence length
1026.0 nt
GC content
0.4795

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-291.80 kcal/mol
Thermodynamic ensemble
Free energy: -315.50 kcal/mol
Frequency: 0.0000
Diversity: 257.70
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((......((((((((((((((((..((....))..)))))))))))..)))))(((((((((((.(((...(((.....)))...))).(((((((..........))))))).........((((.((((.(((...))).))))))))..((((((((.(((...)))..))))))))....((.(((.(.((((.(..((((((...((.(.((((...(((....(((((...(((((.(((((.....))))).))))).....))))).)))....)))).)))..........(((((........)))))((((((((....(((((.((.(((.....))).)).)))))..))))))))....)))))).).))))).))).)))))))))))))....((((....)).))...(((((((.(((.((((((((((((((.(((...(((.((..(((..............((((((((.(..(..((((((..........((((((((((..((((((.(((...((((..(((...)))...))))(((((((((.(((.((((.....((((.(((((.((....((.((((((....)))).))..))......)).)))))))))((((.(((....)))))))..((((((((.....)))).)))).((((.(((...)))))))..((((((((...((......)).)))))))))))).))).)))).))))).....(((((...((((((....(((((...)))))....))))))...))))))))))))))...))).))))))).........))))))..).).))))))))(((((((....)))))))((((((...(((((...............)))))....)))))).)))..)))))...)))))))))).....))))))).))).))....)))))...(((.((((..(((..(((....)))..))).)))).))).)))..
Thermodynamic Ensemble Prediction
,{{......((((((((((((((((..({....})..)))))))))))..)))))(((((((((((.(((...(((,....,))},.))).(((((((.,,.....,.))))))).,,{,{({{(,,((((((.(({...})).}))))),,}))||{|||{{(((,{{|||..|}||||||,...,{.{(({(.,(((,{((..((((..(.({(,{((({{{.,,....((((({,.(((((.(((((,...,))))).))))).....}}}}|,,}},...})))...,.....,,...|{,||}}}}}...,,,})|||{{{||}}..}..}}}},.)),.))}}),,})),}))})}),}})}},......,,,})})})))),.},,.,,))))))))))).,{,,{((....}|,|}.{.(((({{(.(((.((((((((((((({{(((...(((.((..(((..............{(((((((.,,.(..{(((((,.........(((((({(((..((((((.((({{(((((..(({...}}}...)})))},,.,{{{,,{{,,{((...{{(((,.((.,.(((((((({.{(((({....))))},,{{((......,(((((({...(((((.(((....))))))))...,(((((((,{{{.{{,.,...,{,,.,,..,.}})))))}})))}.,))))))))))....}})),},)))))}})))..)),})))),,,,)))|((((...((((((....(((((...)))))....))))))...))))))))))))))...))).})))))).........))))))..,.}.)))))))}{((((((....))))))}(((((({{.(((((......,,...,,,,))))).}}})))))).)))..)))))...)))))))))).....))))))).))).))},..))))).,,|{{.((({..(((..(((....)))..))).)))).))}.}})..

Transcripts

ID Sequence Length GC content
AGAACACAAGCUUUAAAGUAAGUGAAUCAUGUGUGCCUCAUUUAUUUUU… 1026 nt 0.4795
Summary

The outer dense fibers are cytoskeletal structures that surround the axoneme in the middle piece and principal piece of the sperm tail. The fibers function in maintaining the elastic structure and recoil of the sperm tail as well as in protecting the tail from shear forces during epididymal transport and ejaculation. Defects in the outer dense fibers lead to abnormal sperm morphology and infertility. The human outer dense fibers contains at least 10 major proteins and this gene encodes the main protein. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the ODF1 is robustly and specifically detected only in semen samples, confirming its expression specificity for semen identification [Wang et al. DOI:10.1016/j.fsigen.2023.102979]. A preliminary study evaluating mRNA markers for semen identification found that the ODF1 gave inconsistent results during singleplex testing [Haas et al. DOI:10.1016/j.fsigen.2012.10.011].