| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAACACAAGCUUUAAAGUAAGUGAAUCAUGUGUGCCUCAUUUAUUUUU… | 1026 nt | 0.4795 |
The outer dense fibers are cytoskeletal structures that surround the axoneme in the middle piece and principal piece of the sperm tail. The fibers function in maintaining the elastic structure and recoil of the sperm tail as well as in protecting the tail from shear forces during epididymal transport and ejaculation. Defects in the outer dense fibers lead to abnormal sperm morphology and infertility. The human outer dense fibers contains at least 10 major proteins and this gene encodes the main protein. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the ODF1 is robustly and specifically detected only in semen samples, confirming its expression specificity for semen identification [Wang et al. DOI:10.1016/j.fsigen.2023.102979]. A preliminary study evaluating mRNA markers for semen identification found that the ODF1 gave inconsistent results during singleplex testing [Haas et al. DOI:10.1016/j.fsigen.2012.10.011].